HTML

Utolsó kommentek

Amiről itt szó van.

A téma: külpolitikai praktikák, praktikus külpolitikák. És ezek létrejöttének minden politikatudományi, gazdasági, társadalmi és emberi vonatkozása. Egyszóval a külpolitika-elemzés. A bejegyzések szerzői tartalmára vonatkozóan minden jog fenntartva. ---- A blog elsődleges kezelője, de nem az egyetlen szerzője, dr. Marton Péter a Budapesti Corvinus Egyetem tanára.

Háttér

A koronavírus-járvány rögös útján II.

2020.07.01. 22:00 :: Marton Péter

Előzmények (korábbi kutatási jegyzeteim a témában):

2020.07.01-02.

    • Újabb merénylet az értelem ellen. Egy olasz orvos meséli, hogy neki mesélték mások, hogy láttak "furcsa" tüdőgyulladásos eseteket "már tavaly decemberben, sőt novemberben is" (szó szerinti idézet, figyeljünk a részletekre). Ebből (tehát abból, amit mesélt valaki arról, amit mások mesélték neki arról, hogy láttak valamit, amiről nem tudták, mi az, régebben, sőt még annál is régebben) többen arra jutottak, hogy már novemberben járvány volt Olaszországban. Hát igen, a koronavírus megtámadja az emberiség központi idegrendszerét, ezt régóta tudjuk. A lombardiai hivatali szféra annyira komoly, hogy azóta már az ottani ügyészek is szajkózzák ezt a dolgot. (Tekintve, hogy a járvány Kínában a nyílt forrásokból elvégezhető, korroborált rekonstrukció alapján, és azzal párhuzamosan a tMRCA-elemzések szerint is valamikor novemberben kezdődött, nem lehetetlen, hogy már akkor valaki Olaszországba repült volna, de felettébb valószínűtlen, hogy ez már akkor nagy helyi járványt idézett volna elő. Időbe telik, míg egy fertőzött beteg lesz.)
    • Esküvői klaszter az indiai Bihar államban. A vőlegény néhány nappal a vőlegényfogadó tilak ceremónia után lett beteg, az esküvőt még végigcsinálta, két napra rá meghalt. Nem tesztelték, ellentétben a későbbi esetekkel. G.a.h.: +163193+n.
    • U.S. Army SERE-kurzus (túlélés különleges műveleti erőknek). Ideális terep a vírusok terjesztéséhez a sárban fetrengés közepette. 110-ből 90 résztvevő lett fertőzött.
    • Az Egyesült Államokban június eleji állás szerint 24 tagállam, köztük Kalifornia, Florida, Észak-Karolina és New York nem jelentette a (protokollok alapján, tehát nem csak úgy össze-vissza) valószínűsíthető COVID-haláleseteket, ragaszkodva a pozitív laborteszthez, ami más járványok esetén nincs így. Az adatkozmetikai gyógyászat élenjárói. És még Kínára panaszkodtak. (New Jersey egyébként azóta közzétette a valószínűsíthető eseteket).
    • Az Egyesült Államokból eddig 25242 extra halálesetet vettem figyelembe. Most itt van újabb tanulmány híre (Yale) a szezonális átlagot meghaladó halálozásról a teljes országra nézve (+122300 május 30-ig bezárólag). Ha konzervatívan nézem, akkor stimmelnek a számok (levonva az addig meghalt hivatalos COVID-haláleseteket), ez alapján nem adok hozzá a g.a.h. mutatóhoz. De korroborációhoz fontos.
    • A közegészségügy nagyon fontos, kivéve, amikor nem az.
    • Nagyon jó kis videós beszámoló kutakodásról a tüneteken átesett, de antitestre negatív emberek ügyében, amihez a készítő "long-haulerekkel" is (persze nem-reprezentatív és relatíve kis mintájú) felmérést végzett. Elmélet arról, hogy a mieloid immunválasz dominanciája esetén adódnak a hosszú távú tünetek, és hogy ilyenkor kevesebb (vagy hamarabb hanyatlik) az antitest-titer (kis immunológiai háttér ehhez itt). Mellékesen az derül ki, ami azért elég jól sejthető volt eddig is, hogy a tesztelés megbízhatósága (mind a PCR-vírusteszt, mind az IgG/IgM antitest-tesztek esetében) elég gáz a gyakorlatban.
    • A trombociták hiperreaktív viselkedéséről COVID-nél. Mindezek hátterében a transzkriptómában kifejeződő változások (egészséges vs. nem-egészséges között sokkal inkább, mint ICU-ra bekerültek és be-nem-kerültek között). Az eltérő génkifejeződések egy része egyébként pl. H1N1-nél is megjelenik, bár "sok" közülük egyedülálló a SARS-CoV-2/COVID kapcsán. Büszke vagyok, mert az emelkedő P-szelektin szerepét ezen a blogon május 7-én előre jeleztem. A reaktív oxigéngyökök szintje is emelkedett, naná — oxidatív stressz.
    • Ez a cikk elviccelődik azon, milyen rossz lehet egy négy órán át tartó rendellenes erekció. Kicsit kiszámíthatóan és olcsón csinálja, és aztán kiderül, hogy a beteg lélegeztetőgépen volt, öntudatlan/leszedálva, és az életéért küzdöttek, amikor ez történt vele. COVID-os, vérrögökkel a péniszében. Ez ma a mainstream sajtó?
    • Merkely Béla nyitott lenne arra, hogy mindenki szűrethesse magát, aki akarja, mert nyilván okkal kér ilyesmit, ha úgy alakul, hogy kérné. Erre másoknak is nyitottnak kellene lenniük. Miért? Mert különben nagy gáz lesz, azért.
    • Merkely egyébként nekem a híreket is folyamatosan követő embernek tűnik. Szóval... csak nem emiatt jelezte, hogy gond lehet? Szerbiában elképzelhető, hogy háromszor annyi áldozata volt a járványnak, és még most is eseteket titkolnak el szép számmal. Az idézett német cikk a témában. Kiszivárgott információ szerint június elejéig a hivatalosan közölt 244 helyett 632-en halhattak meg. A szerb járványügyisek közben alig kaptak adatot, ezek szerint vakon repültek az eltelt időben. Ezek nagyon súlyos dolgok, ha bebizonyosodnak. Kieg.: kicsit utánaolvasva ez sajnos úgy van, ahogy mondják. A kiszivárgott adatokból a pozitívra teszteltek végállapota volt ki- és összeolvasható, intézményi bontásban Nistől Belgrádig, és ebből áll össze a kép, hogy mennyi halálesetet hallgattak el. G.a.h.: +163581+n.

2020.07.03-05.

  • Dr. Hansen tapasztalatai COVID-betegekkel. Amikor a betegek száma áradásszerűen nő, elfogynak a negatív nyomású izolációs szobák, és a lélegeztetésnél mindjárt kevesebb az opció. CT-re küldeni kockázatos is, miközben életmentő is lehet. Volt betege, akinél pneumatocele (tüdőciszta) alakult ki a tüdőgyulladás nyomán. Sok a túlsúlyos beteg (BMI).
  • A kommentek között került elő tegnap, és fontos: számos szegény ország van, ahol a plazmakezelés fertőzéskockázattal járhat (HIV, HCV stb.).
  • Tanulmányok. Pszichotikus epizódok COVID-nél. Multisystem Inflammatory Syndrome in Children (MIS-C) New York államban (amit Kawasakiként írnak le sokszor).
  • Egy teherautósofőr szomorú története Kaliforniából. Júniusig következetesen elszigetelte magát, mivel diabéteszes és túlsúlyos is volt. Aztán elment egy baráti összejövetelre.
  • A sample pooling, amit az információs hadviselés háborús bűnelkövetői letámadtak tudománytalan dologként, jön az Egyesült Államokban.
  • Szerbiában rendkívüli helyzet Belgrádban, és kormánytagok fertőzöttek. Elgondolkodtató lehet.
  • Közben egy kutatási projekt kapcsán a nagy tengerszint feletti magasságon élők/tartózkodók egészségégről olvasgatok éppen, és alapvető, hogy ott csökkent a szívteljesítmény, illetve az oxigénfelvétel, és sztenderd állapot a hipoxia. És akkor gondoljunk bele, hogy Bolíviában mekkora járvány van éppen...
  • Egy másik dolog, amin gondolkodtam, a D-vitamin-szint. Mivel az most átlagosan magasabb a népességben, talán valamivel kevésbé lesz halálos a járvány ezekben a hónapokban. Így is sok ember hal meg, persze, de százalékokban kifejezhető különbség adódhat. Mármint adódhatna, ha lehetne ehhez tökéletes eset-felderítést végezni, de az nyilvánvalóan eléggé macerás, leginkább annyira, hogy lehetetlen. (Ami pedig az Egyesült Államokban és hasonló helyeken történik, azon ez nem sokat segít, ha pl. az intenzív osztályok nem bírják el az áradatot, és betegek nagy számban kapnak szub-optimális ellátást.)
  • A fizikai fogyatékossággal élők fokozott veszélyeztetettsége. Eszembe jutnak erről a vérrögök. Immobilisnak lenni COVID-nél például azért lehet különösen rossz dolog.
  • Santa Clara megyében, Kaliforniában olyan jól sikerült egy értekezlet az iskolák újranyithatóságáról, hogy most karanténban vannak a résztvevők.
  • A Worldometersnél most először hibásak a magyar adatok. A két új eset regisztrálódott, de az újabb elhunyt nem (589 halott a Worldometersen most szereplő 588 helyett). Ilyet eddig még nem láttam itt, azért jegyzem meg. A koronavirus.gov.hu-n ellenőriztem, ott fent van a +1 halott. A CFR így most 14,11%. Kieg.: már javították is.
  • Japán, szezonális átlagot meghaladó mortalitás. Ebből a cikkből vettem eddig figyelembe ilyen adatot, ez márciusra vonatkozott. Ez a cikk most áprilisról tesz említést, +1000 halálozással. Áprilisban 373 COVID-haláleset volt Japánban hivatalosan (amikorról van április 7-i adatom, miszerint 22 ezer lélegeztetőgép több, mint 40%-át használták éppen), így ha 10%-nyi COVID-független extra halálozást számítok, és minden COVID-halálesetet az extra részeként veszek figyelembe, szokás szerint konzervatívan, akkor adódik +564 extra, a járványhoz kötődő haláleset. G.a.h.: +164145+n.
  • Pittsburgh, koronavírus-bulik, ahol a mihamarabbi fertőzés versengés tárgya. Fattening the curve.
  • 81 éves texasi betegtől megtagadták a plazmakezelést, mondván, életkora miatt "nem fért be a vizsgálatba", amelyben a plazmakezelést alkalmazzák. Olyan mértékben sikerült túllőni a kórházi kapacitásokat perspektivikusan, hogy lesz itt még szűkösség nagyobb is.
  • Közben Ausztráliában, ahol most a téli szezon van (11 fok körüli hőmérséklettel), szintén nagyobb járvány van kibontakozóban.
  • Olaszországban pedig Szerbiából sikerült reimportálni a betegséget. Üzleti útról férfi hazatért június 25-én, már beteg volt, de elment bulizni is, meg egy temetésre is. 28-án már kórházi látogatást tett, de pozitív teszt nyomán haza távozott. Július 1. után intenzív osztályra került. Döntéshozók figyelmébe: Szerbia lehet az új Irán?

2020.07.06-08.

  • Esett már szó fentebb a trombociták hiperreaktivitásáról... COVID-nél a tetejében a trombocitákat előállító megakariociták felszaporodása a tüdőben és a szívben (tanulmány, Lancet), ez is hozzájárul a pro-trombotikus állapothoz.
  • Erre a kezdeményezésre is érdemes lesz figyelni hosszabb távon: a COVID-19 Host Genetics Initiative. Korábban írtam itt kutatási eredményekről, melyek az ApoE e4 genotípus fokozott kockázatnak való kitettségét találták. A kutatások viszont itt nem állnak meg, lesz még sok új eredmény, amiből aztán egy nagyobb képet lehet kialakítani.
  • Itt egy friss sajtócikk is a gazdagenetika témájában; még neandervölgyi géneknek is szerepe lehet a történésekben. Erről a tanulmányról számoltak be a cikkben. A 3-as kromoszóma egy régiója a fokozott érdeklődés tárgya, 49400 bázispárnyi. Haplotípus, jellemzően együtt öröklődő gének csoportja. Ilyen hosszú haplotípus akkor adódik, ha jelentős túlélési előny kötődik hozzá, vagy nincs sok rekombináció valamiért ezen a környéken, vagy szerzett programcsomag, pl. neandervölgyiektől. Az idézett kutatás a horvátországi neandervölgyi lelet (Vindija 33.19) DNS-ével találja a legerősebb hasonlóságot (kevésbé adott a szibériai esetében).
  • A mi számainkon elgondolkodtam közben. Ha 286000+ mintavétellel sikerült megtalálni 4189 esetet eddig, akkor egy pozitív esetre jutott közel 70 mintavétel. Tekintve, hogy a CFR nálunk 14% felett van, vagyis minden bizonnyal sok a felderítetlen eset, az egy pozitív tesztre jutó 70 mintavétel a tesztek pocsék szenzitivitását is jelezheti. Persze ha abból indulok ki, hogy egy személynél több mintavételre is szükség lehet (elsőre még nem tesztel pozitívra, vagy a kórházi elbocsátáshoz meg kell nézni, hogy negatív-e már), akkor a 70 felezhető, harmadolható lehet. Jó lenne tisztábban látni ezekkel a számokkal kapcsolatban.
  • Izraelben érdekesen alakulnak a dolgok (rosszul). A belbiztonsági szolgálatra, a Shin Betre bízták korábban a kapcsolatkövetést, az pedig meg is csinálta az összes rendelkezésre álló (kém)technológiával, gyorsan. Márciustól májusig vagy 4600 embert különítettek el ez alapján preventíven. Viszont nem annyira alkotmányosan, ha a magánszféra védelmére egy picit adunk, mint azt az izraeli Legfelsőbb Bíróság megállapította. Mostanra újranyitottak (valamennyire), és elkapta őket egy második emelkedő hullám. Netanyahu persze rögtön szerette volna, hogy a Shin Bet újfent nekiveselkedjen az adatgyűjtésnek. Tény, hogy az eü. személyzet nem bírja az iramot már, ilyen esetszámok mellett (össz 30 ezer felett, új esetek naponta százas nagyságrendben). De van pl. peer-2-peer kapcskövetés is a világon, úgyhogy nem biztos, hogy a megfigyelőállamra lenne ehhez szükség feltétlenül, mondják mások. A Knesszet július 1-én mindenesetre megadta a Shin Bet-féle program újraindításához a felhatalmazást, a Legfelsőbb Bíróság által előírtak szerint törvényt alkotva erre a célra. Közben vannak újra komolyabb korlátozó intézkedések, rendkívüli helyzet. Már most 6-7%-os gazdasági visszaesésre, és értelemszerűen további halottakra lehet számítani, egy olyan régióban, ahol sem a demográfiai, sem a gazdasági folyamatok nem tudnak igazán közömbösek lenni — az aktuális hatásoknak a környéken mindenki ki van téve persze. Az impakt nem csak gazdasági és biztonsági, szimbolikusan is jelentős; a járvány az idős holokauszttúlélőket különösen veszélyezteti (az első izraeli halálos áldozat maga is a Shoah túlélője volt). Még egy adalék közben: a Palesztin Hatósággal közös operatív törzs működik járványügyben. Ezzel össze is foglaltam az InfoRádiónak adott interjúmat, meg még egy kicsivel többet is.
  • Egy különösen csúnya történet. Nick Cordero színészről korábban már írtam itt, trombózis miatt elvesztette a lábát COVID-betegként. Ami most derül ki: azóta sem gyógyult fel. Májusban orvosi kómából ébresztették, gyenge maradt, és most meghalt. Hónapok után. 41 éves volt.
  • Érdekes lenne tudni, hány embernél döntöttek az orvosi kóma mellett összesen. Itt egy másik eset, egyelőre túlélő. Az orvosok bizakodók, de szeptember előtt nem nagyon küldik haza. Az egyik dolog, amit az orvosi kómáról tudni érdemes, amikor így, hónapokra alkalmazzák, hogy utána teljes felépülés nem nagyon van.
  • Görögország nem engedélyez beutazást Szerbiából. Just sayin'.
  • Probléma a HIV/AIDS kezelését szolgáló szerek elérhetőségével a láthatáron számos országban. 2019-ben 8,3 millióan szedtek antiretrovirális szereket (ARV-ket). 73 ország jelzi, hogy fogytán a készletei.
  • Spanyolország, adatok az IgG antitestek előfordulásáról (szereprevalencia). Országos szinten 5% körül. 
  • Térjünk vissza egy kicsit a vírus eredetéhez. A denevér-tobzoska-rekombináció-zoonózis elmélet (Occam borotvája jelen állás szerint veszélyes rá) és William Gallagher copy-choice error elmélete mellé ugye van más is, amihez ez a Times-cikk szépen összeszedi a Shi Zhengli-féle kutatócsoport tevékenységének furcsaságait: hogy az RaBtCoV/4991 és az RaTG13 azonosságát elhallgatták publikációkban; és hogy a 2012-es bányajárványról sem számoltak be, aminek kapcsán ezt a vírust felfedezték, miközben egyébként gain-of-function kutatásokkal is foglalkoztak; és hogy ezek a dolgok valahogyan azután sem kerültek elő általuk egyenesen megemlítve, miután az RaTG13 és a SARS-CoV-2 96%-os genomegyezéséről maguk számoltak be.

Folyt. köv.

2 komment

A koronavírus-járvány rögös útján, tovább

2020.06.15. 08:53 :: Marton Péter

Előzmények (korábbi kutatási jegyzeteim a témában):

2020.06.15.

  • Így vált a COVID-19 az egyik vezető globális halálozási okká, vizualizáció. (Kieg.: A G7 is megosztotta az ábrát, és számos kommentelő írta felháborodva, hogy de hiszen rákban többen halnak meg. Hát, nem fogom sajnálni a koronavírust, de ez a sorsa, úgy tűnik. "Á, hát hol van ez az influenzához képest", mondogatták anno egyesek. Miután az a szöveg nem jött be, most a rákkal és a szív- és érrendszeri betegségekkel jönnek. Azokat a SARS-CoV-2 nem fogja tudni lekörözni. De ha mégis sikerülne neki (mondom, nem fog sikerülni neki, csak az irónia kedvéért írom), akkor mi következne? Hogy "nem ebben fogunk kihalni"?)
  • Erről eszembe jutott még valami. Május 24-én volt az itt közölt adat szerint 256795 maláriás haláleset idén (2018-ban csak 405 ezer volt egész évben). Úgyhogy elmondom, hogyan lehet az afrikai országokban olyan alacsony a halálozási arány COVID-nél. Úgy, ha pl. a szokásosnál többen halnak meg maláriában. Mármint hivatalosan. Ehhez rossz szándék nem kell. Lázas beteg fájdalmakkal meghal, mélyreható vizsgálódás nélkül nincs nagy különbség ott, ahol ehhez hozzászoktak, és nincs nagyon eü. infrastruktúra.
  • Peking eddig egész jól megúszta. Kezelni fogják a helyzetet, de a fővárosban ez nagyobb zavar forrása, mint Wuhanban.
  • Arról, hogy az Indiából jövő adatok mennyire problémásak. Orvosilag évente a halálesetek 22%-át vizsgálják csak. Kieg.: e szerint a forrás szerint a halálesetek 70%-át regisztrálják csak (normális körülmények között...), és azok ötödére igaz, hogy van orvosilag megállapított halálok.
  • Spanyolország egészen hihetetlenül pofátlanul jár el a koronavírusos halálesetek (nem-)jelentésével. Ugyanitt adat arról, hogy eddig volt minimum +43000 szezonális átlagot meghaladó halálozás idén. Eddig 4500 halálesetet számoltam el ilyen kategóriában összesen, úgyhogy itt konzervatívan, de a 43000 háromnegyedét figyelembe fogom venni (tekintve a már eddig is komolytalan adatszolgáltatást), és abból vonom le a 4500-at (kijön 27750). G.a.h.: +111168+n.
  • Mint Svédország, Spanyolország vagy Nicaragua esete mutatja, a valóságtagadó (eufemisztikusan lásd még: "post-truth") politizálás bal- és jobboldalon is előfordul, és ronda egy nyavalyája az emberiségnek.
  • Apropó, Nicaragua és járványtagadó vezetés. Costa Rica elég komoly negatív kicsordulási hatást kap tőlük a munkásmigráció kapcsán. Korábban már a Pan-American Health Organization határozott intervencióját is kérték a szomszédok háza táján.
  • Kísérletek egy új szerrel (TRV027), mely egyszerre blokkolja az AT-II-t és pótolja az AT 1-7 hatását, hogy normalizálja a vérnyomást, és ezzel segítsen kezelni a vérrögképződéssel kapcsolatos problémákat is.
  • Ebből az elemzésből (a KKI-től, Németh Ferenc munkája) megtudható pl., hogy Észak-Koszovóban jelenleg is Szerbia rendelkezik effektíve a közegészségügyi intézkedésekről, és a koronavírus-tesztjeik is Szerbiába mennek.
  • Burundi elnöke, Pierre Nkurunziza elhunyt, minden valószínűség szerint COVID-ben. Ő lenne a második halott az országban, de jaj, ő maga gondolta úgy, hogy a járvány felesleges para, elég gyakorolni a vallást buzgósággal, ezért őt nem is tesztelték. A felesége még korábban Kenyába repült kezelést kapni, az Aga Khan Foundation ottani kórházában. G.a.h.: +111169+n.

2020.06.16.

  • Ez a tanulmány kihozta, hogy a belga eü. személyzetnél nem volt nagy a betegekkel érintkezés rizikója (nyilván PPE-kkel és protokollokkal menedzselték sikeresen) — egyéb tényezők inkább determinálták, ha fertőzöttek lettek (pl. háztartásban beteg). A belga ápolók viszont nem egészen elégedettek a támogatással, amit kaptak, és éppen perre mennek emiatt.
  • Új-Zélandon újra van eset. Két nő jött haza Angliából, és méltányossági alapon lerövidítették a karanténjukat, hogy meglátogathassanak egy halálán lévő családtagot — 650 kilométerre, Aucklandből Wellingtonba hajtottak ehhez.
  • Nálunk egy új esetet találtak (meg). A CFR tovább emelkedett, most már 13,85%.
  • Bangladesben leégett egy kórházi szükségrészleg, öt COVID-beteg meghalt. G.a.h.: +111174+n.

2020.06.17.

  • Egy csöppet over-the-top cím a BBC-n: "Dexamethasone proves first life-saving drug". Szteroidokat természetesen eddig is használtak a túlpörgött immunrendszer fékezésére a súlyos eseteknél. Itt állítólag olyan jók az eredmények, hogy egyharmaddal csökkenthető lehet a lélegeztetőgépre szorulóknál a halálozás. Úgy legyen! Az előbb-utóbb beérő finomhangolások a kezelésben idővel mindenképpen csökkentik az Infection Fatality Rate-et. És akkor jöhetnek majd a boldog tudatlanok magyarázni, hogy nem is volt olyan halálos ez a vírus. Hiszen eddig "csak" félmillióan haltak meg benne, akik "nyilván" mind amúgy is gyakorlatilag halottak voltak (a javuló kezeléssel persze lehet, hogy mégsem...). Legyen meg a boldog tudatlanok akarata.
  • Úgy tűnik, Kínában komolyan aggódnak amiatt, hogy esetleg a fagyasztott lazaccal hozták be a vírust.
  • Aggódnak a vírus terjedésének gyorsasága miatt is.
  • És éppen az ilyen esetek miatt különös (értsd: feltárandó, megalapozott magyarázatra szorul), amit például Magyarországon látunk. Nálunk minden jel (a szennyvizes adatok, a halálesetek számának lelassult növekedése, illetve az európai mortalitásfigyelőnél látható normális halálozási mutató) arra utal jelenleg, hogy szerencsére elmaradt ez a fajta robbanás. (A regisztrált esetek számát nem érdemes nézni — mára a CFR megint tovább nőtt, most éppen 13,9%.) Kórházi dolgozók tették ki közben az ismert fertőzöttek 15%-át, és csak egy személy halt meg közülük (600-nál több fertőzött közül, és 564 másik haláleset mellett), miközben pl. Oroszországban már 416 eü. dolgozó halt meg a ma reggeli állás szerint. Szerencsénk van? A korai korlátozások és a szerencse a magyarázat, együttesen? Nem mindegy, az esetleges következő hullám elé tekintve. 
  • Indiában közben halálozási rekord, részben adatkiigazítások miatt. Sajnos a vasúti kocsik kórházzá konvertálása pontosan jelezte, mennyire súlyosra fordult az ottani helyzet. Kétezernél több halott egy nap alatt, a hivatalos adatok szerint.
  • India és Kína között összecsapások voltak a Himalája térségében.
  • Minneapolist nem követtem egy darabig. A városi tanács deklarálta, hogy teljesen fel akarják oszlatni a városi rendőrséget, mert a reform nem elég, de ezzel messze nincs vége a történetnek. A rendőrség nagy reformok ígéretével igyekszik kivenni a szelet a kezdeményezés vitorlájából. Ezzel egyfajta alkufolyamat zajlik, ha jól érzékelem. A városi tanács döntése látszólag a "Defund the Police" kezdeményezéssel rezonál — sajnos nem feltétlenül konstruktívan. Ahelyett, hogy lenne egy egészséges vita arról, hogy milyen feladatokkal nem kellene terhelni a rendőrséget, vagy hogy maga a rendőrség mitől működne jobban, a különféle támogató és ellenzőtáborok tüzét fűti a deklaráció. Közösségi egymás nyakába borulásról álmodnak az egyik, anarchiáról rémálmodnak a másik oldalon — megoldásokra pedig a valóságban van szükség.

2020.06.18.

    • Németország. Újabb húsfeldolgozós klaszter. Fagyos munkakörülmények, zsúfolt munkásszállók kelet-európai munkásoknak. És a kötelező idiotizmus a munkaadók részéről: "biztos otthonról hozták magukkal ezek".
    • A hondurasi elnök és felesége is pozitívak, az elnök beteg.
    • Az iskolák is lehetnek jelentős terjedés terepe. Izrael.
    • A night out in Florida. Klaszterek, klaszterek, klaszterek.
    • Adatkészlet arról, ki mennyiszer szolidarított meg, és kiket, a járvánnyal kapcsolatban az EU-ban. A németek vezető helye nem lepett meg, de érdekes pl. a cseheket ott látni a szolidaritási toplistán.
    • A BBC 27 ország excess mortality adatai alapján minimum 130 ezerre teszi a járvány (közvetlen és közvetett, pl. kieső eü. ellátás miatti) áldozatainak számát a hivatalos adatok felett (mindenhol megnézve, mennyi az "other excess deaths", tehát minden COVID-19-es halálesetet extrának tekintve, konzervatívan). Én ugyebár külön dolgozom, all-source jelleggel, ugyanezen a mutatón, nézzük, mi számít az ő adataik közül az én mutatóm esetében. (Korábban figyelembe vett számokat levonva, a különbözetet egységesen mindenütt 10%-kal csökkentve, azaz feltételezve, hogy járvány nélkül is mindenhol lett volna ennyi excess mortality.) Chile: +1963. Ecuador: +7749. Jakarta: +2983. Irán: +3988. Japán: +225. Hollandia: +3376. Peru: +11463. Portugália: +1383. Dél-Korea: +1107 (itt feleztem, azaz többet levontam, a különösen intenzív tesztelésükre tekintettel). Thaiföld: +2084. Az Egyesült Államokból eddig 9548 halálesetet vettem figyelembe, így: +15694. G.a.h.: +111174+52015+n=+163189+n. (Ha valakiben felmerül a kérdés, hogy lehet az én konzervatívabb számítási módom mellett több a végső számadat, mint a BBC-nél: én több országból néztem, és a BBC által vizsgált adatok származási periódusánál jóval tágabb időszakban, az addicionális halálozást.)
    • Azt jó tudni, hogy a hivatalos kínai lazacpánik közepette legalább a kínai CDC azért nem az importlazacot gyanúsítja elsősorban.
    • Trump szerint a koronavírus kihalóban. Pence is megtartotta a kötelező kis "mission accomplished" beszédét.
    • A brazil őshonos népességet nem kíméli a vírus.
    • Na, akkor dolgozzunk egy kicsit. Ez a paper a D614G mutációt azonosította (az S-fehérjében) jelentősen nagyobb transzmisszivitás (és a virionon nagyobb mennyiségben és stabilabban kifejeződő S-fehérjék) forrásaként. Ennek a szekvenciája, a 614-es pozíció környékén (1273 aminosavból): SNQVAVLYQDVNCTEVPVATH helyébe lép SNQVAVLYQGVNCTEVPVATH (614-nél glicin lép az aszpartát helyébe; a Wuhan-Hu-1-esnél pl. még aszpartát volt). Kérdés: a Magyarországon izolált vírusoknál jelen volt-e ez a mutáció? Ha az alábbi idővonalat követjük, a G térnyerése a nálunk viszonylag korán bevezetett korlátozó intézkedéseket követi.

sarscov2_d614gmutation.jpg

  • Hipotézis: ezt a mutációt sikerült volna kizárni a korlátozásokkal? Lényeges kérdés, mert akkor a nemzetközi forgalom újbóli élénkülése mellett a G térnyerése újra elképzelhető.
  • Még mielőtt én böngészhettem volna át néhány vírusgenom-szekvenciát, szembejött ez a paper itt. Ezek szerint a hCoV-19/Hungary/mbl1/2020 pl. hordozza a D614G mutációt. Ezt március 17-én töltötték föl, GISAID kódja 416426. Budapestről származik. Tehát itt volt, legalább egy izolált vírusnál jelen. By the way, itt a P4715L mutáció is adott az RdRp-ben (RNS-dependens RNS-polimeráz), amelyről szintén az a tapasztalat, hogy a releváns változások egyike.
  • Kérdés, mi a helyzet a többiekkel? Hungary/SRC-00066/2020 (Baranya, GISAID 435403), Hungary/SRC-1788lc/2020 (Szeged, GISAID 435425), Hungary/MBL-469/2020 (Balassagyarmat, 435424), Hungary/MBL-465/2020 (Balassagyarmat, 435423), Hungary/MBL-464/2020 (Balassagyarmat, 435422), Hungary/mbl2/2020 (Baranya, 418483), Hungary/SRC-01136/2020 (Baranya, 435418), Hungary/MBL-003/2020 (Balatonfüred, 435421), Hungary/SRC-02801w/2020 (Békésszentandrás, 435428), Hungary/SRC-03670w/2020 (Kecskemét, 435430), Hungary/SRC-00105w/2020 (Kecskemét, 435426), Hungary/SRC-00126/2020 (Baranya, 435405), Hungary/SRC-00055/2020 (Baranya, 435419), Hungary/SRC-00417/2020 (Baranya, 435409), Hungary/mbl49/2020 (Baranya, 416744), Hungary/SRC-00067/2020 (Baranya, 435404), Hungary/SRC-00419/2020 (Baranya, 435410), Hungary/SRC-00792/2020 (Baranya, 435412), Hungary/SRC-00620/2020 (Baranya, 435416). Megjegyzés: kicsit sok a Baranya (PTE, értem én) — a nagyobb diverzitás jobb képet adna.
  • No, itt egy másik paper. Ez 3/3 magyarországi szekvenciában találta meg a D614G-t. Sajnos nem jelöli, melyikeknél a fenti listából. Mindenesetre így 3-4 példányról tudunk, ahol a D614G megvolt. Ez így azt sugallja, hogy nem ez a magyarázat a vírus "nyaralására" Magyarországon.
  • Egy 1983-as tanulmány az északkeleti országrészről. Szerológiai vizsgálat, 2881 mintából 58% volt pozitív OC43-as koronavírus elleni antitestekre. Hoppá. 15-19 év közöttieknél 70% a szint. Ez már inkább lehet része a magyarázatnak, amit keresek — bár 1983 régen volt... Mennyi lehet a keresztimmunitás?
  • Mielőtt túlzottan örülni kezdenénk, azért megjegyzem, hogy a CFR tovább nőtt mára. Most már 13,92%.
  • Kínai tanulmány. (Csak) 3,2-3,8%-os szeropozitivitás Wuhanban (még március és április eleje között mérve, ami IgG/IgM szempontból nem közömbös).
  • Újságíróknak, akik ezt olvassák, és támaszkodnak rá: az én időm is drága. Nyilván tök jó, hogy így összeszedem ezeket a dolgokat, plusz közzéteszem vele együtt a saját elemzésemet is — ugyanilyen jó, ha hivatkoznak is rá, amikor innét találnak hasznos anyagokat és információkat. Habilitált docens vagyok a Corvinuson, úgyhogy igazán nem kell szemérmesen elhallgatni a forrást.

2020.06.19.

2020.06.20-21.

  • Készül Trump nagy kampányeseménye Tulsában, Oklahomában. Állítólag tesznek majd ki maszkokat is önkéntes használatra, de a résztvevők számára mostanra vallási kérdés, hogy nem nagyon akarnak ilyesmit viselni. Figyelembe véve a paramétereket (résztvevők száma, fertőzöttek vélhető aránya a populációban, szuperterjesztők vélhető aránya stb., akár néhány száz fertőzés is összejöhet egy ilyen alkalommal).
  • Floridában betelőben a kórházi intenzív osztályok. (Arizona sem áll jól.)
  • A CFR nálunk tovább nőtt, most már 13,95%.
  • 18 éves COVID-beteg férfi kettős tüdőátültetése Olaszországban.
  • Ez a cikk megy most köröket a magyar interneten. Országok erős BCG-átoltottsággal és anélkül, összehasonlítva. Kár, hogy nem is. Mert miközben a teljes adatuniverzumra elvégezhető lenne az elemzés, a szerző kiválasztott nyolc ilyen + nyolc olyan országot. Az önkényes szelekció pedig nem túl meglepő módon torzítja az BCG-átoltottság szerepének megítélését, nem reprezentatív. Type I error. Itt lehet tanulmányozni a BCG-vel kapcsolatos országadatokat. 

2020.06.22-23.

    • A húsfeldolgozók (pl. Gütersloh) hatása az R0-ra Németországban. A Bundeswehr is részt vesz a tömeges tesztelés megszervezésében a környéken, és elképzelhető, hogy lesznek mobilitási korlátozások is.
    • Victoria állam, Ausztrália. Családi és szállodai klaszterek.
    • Egyre inkább úgy találják sokan, hogy a terjedésben a kb. 20%-ot kitevő szuperterjesztők játszhatják a domináns szerepet, miközben mások nem terjesztők egyáltalán. A szuperterjesztők jelentőségét illetően nem kételkedem, a tömeges nem-terjesztésben viszont nagyon is. Azért itt egy hongkongi tanulmány is, amelyik a szuperterjesztők dominanciáját találja megállapíthatónak. Mint az alábbi ábrán látható, sok volt a "szociális" közegben történő terjedés (baráti kör, szabadidős tevékenység másokkal), és a munka- és a családi kapcsolatok kisebb szerepet játszottak az itt megfigyelt esetekben. Ez a szórakozóhelyeknek, a tornatermeknek vagy éppen a bent fogyasztó vendégekben reménykedő éttermeknek pl. rossz hír lehetne, ha a politikusoknak az emberi élet védelme lenne a legfontosabb. (Mondjuk ahhoz elég hosszú azért a memóriám, hogy emlékezzek, Kínában pont a háztartáson belüli transzmissziót találták gyakorinak, és ez vezetett anno az erős aeroszolizáció feltételezésével szembemenő következtetésre. Mostanra viszonylag egyértelműen látszik, hogy van itt ez is, az is.)

 sarscov2_hongkongstudy_superspreadingdominates.png

2020.06.24-25.

  • A járvány kezelése Thaiföldön. Nagy hangsúlyt fektettek a kapcsolatkövetésre, mivel az költséghatékony. A lakosság fegyelmezett maszkviselőnek bizonyult — 95%-os normakövetés, azt írja a cikk. A piroslámpás iparágat nagyrészt leállították a járvány idejére.
  • Jájj. Eddig nem figyeltem, miket mondott Trump Tulsában, a kampánygyűlésén, pedig kitett magáért most is. Hogy ő lelassíttatta a tesztelést, hogy ne legyen már annyi eset, és azzal együtt hülyenegatívsajtó. Később persze elmondta azt is, hogy nem azt mondta, amit mindenki hallott, hogy mondott.
  • Nálunk közben meghaladta a 14%-ot a CFR.
  • Izrael: hogyan lesz egy 24 éves kosárlabdázó srác magas vérnyomásos, vérhígító tartós szedésére utalt, depressziós stb. A COVID-tól.
  • Nem fáradnék a link előkeresésével. John Ioannidis kihozta egy paperében, hogy 0,04% körül lehet a SARS-CoV-2 fertőzés-halálozási aránya. Miközben Belgiumnak lassan a 0,1%-a halott a járvány miatt. Ezt az embert tegnap kellett volna kidobni a Stanfordról. Vagy nem is tudom... muszáj volt egyáltalán beengedni oda?
  • Másik kedvenceim, a svédek kormányzatilag panaszkodnak, hogy a környező országok utazási korlátozásai velük szemben "mindennél fájdalmasabbak". Azért egy COVID-betegnek lehet, hogy vannak nagyobb fájdalmai is.
  • Az utazási korlátozások feloldásánál pedig ez a felelős megközelítés. Buborékképzés. Például ezt csinálja Új-Zéland a Fidzsi-szigetekkel. Ők nem kicsit következetesebben, mint az európai kormányok, de azért még az európai kormányokat is foglalkoztatja valamennyire, hogy kinek nyitják ki az ajtót a járványügyi megfontolásokat figyelembe véve.
  • Az Egyesült Királyságban végül elég lesz 1-2 méter az emberek közé a tömött szórakozóhelyeken. Nem bízzák a véletlenre.
  • Itt említik, hogy már Egyiptomban is meghalt közel-száz eü. dolgozó. Ez globálisan már 1500+ eü. dolgozó így.
  • A COVID-19 esetenként diabéteszhez vezethet. In vitro tenyésztett hasnyálmirigyekkel is vannak eredmények, de az organoidos eredmények mellé még további kutatás kell majd.
  • Houston, you have a problem.
  • Tanulmány nőkről (n=91412, CDC). A terhes nők 31,5%-a kapott kórházi kezelést (mondjuk a nagyobb arány részben nyilván az extra óvatosság következménye is, megjegyzem). A nem-terhes nőknek csak 5,8%-a. 
  • A probléma léptéke: az Egyesült Királyságban jelenleg százezres nagyságrendben kellene önkaranténezniük magukat az embereknek ahhoz, hogy a terjedés kezelhető legyen (ez a kapcsolatkövetésből gyűjtött adatok eredménye; meg is kérték az érintetteket egyébként).
  • Még pár gondolat az Egyesült Államokról. Breonna Taylor eü. dolgozó lelövése után nem volt még robbanás — március közepén —, mivel éppen akkor mindenki inkább bezárkózott. Pedig az az incidens is tökéletes lehetett volna gyújtózsinórnak. Derek Chauvin rendőr brutalitása félelmetesen hatékony időzítéssel gyújtotta lángra a közharagot. Mi lesz, ha legközelebb a rendőrségnek széles körű kijárási korlátozásokat kell majd betartatnia tömegekkel? A járványügyi helyzet ebbe az irányba tart.

2020.06.26-28.

  • Jemenben azon versenyeznek a houthik és a kormányerők által ellenőrzött régiók, hogy ki tudja jobban eltagadni a járványt.
  • Az utóhatások, miután szociopata, valóságtagadó politikusok elhitetik a népekkel, hogy a gravitáció véleménykérdés. 
  • UK, élelmiszergyári kitörések, a terjedés terepének a közös étkezdei ebédelés és a közös kocsiztatás tűnik.
  • Ez egy jó kis elemzés (h/t @rdos). A regressziós modellből az jön ki, hogy a június 2-i esetszámot nagyban determinálja (85%-ig) a kijárási korlátozások bevezetésekori esetszám (a járványszerűen gördülő teher mértéke), az első eset és a kijárási korlátozások bevezetése között eltelt idő (gyors intézkedés), a tesztelés mennyisége, illetve a népsűrűség. A népsűrűség a legkevésbé jelentős. A kijárási korlátozások szigorúsága kevésbé számít, mint a gyorsaság, illetve a gördülő teher induláskori mértéke. A tesztelésmennyiség sajnos fontos "zaj" forrása viszont, mivel a magyarázandó változó értékének a bizonytalanságához kapcsolódik. A modell pontossága tehát leértékelődik azzal, ha olyan értékeket magyaráz jól, amelyek nem valósak — ezt kénytelen vagyok hozzátenni. De intuitíven nem tűnnek helytelennek a járványpolitika számára adódó következtetések (=több tesztelést; gyors, határozott intézkedést; szigorúság tekintetében a pragmatizmus megengedhető az előbbi kettő teljesülése esetén).
  • A franciák nem tudnak leakadni a HXQ együtt-használatáról azitromicinnel, de az eredmények náluk (n=3737, ebből 3119 kapta a HXQ-s kúrát, 618-an mást) a HXQ javára szólnak.
  • Orvosi protokollok témában itt a NEWS-pontszám számítási metódusa, ma találkoztam vele. Testhő 35 fok alatt +3 pont. 
  • A világgazdasági kilátások negatív módosulása (--4,9%) az IMF előrejelzésében (h/t @orsklutsch).
  • Miért van Peruban nagy járvány a hosszú lockdown ellenére is? Mindennap bevásárlás, nincs fridzsider a háztartások 40%-ában. 70% az informális gazdaságban dolgozik, nincs otthonmaradás. COVID-segélyt a bankban kell felvenni személyesen. Sok a túlzsúfolt háztartás.
  • Kenya, motorbicklis taxisok tüntetése a korlátozások ellen. A rendőrség három embert lelőtt. G.a.h.: +163192+n.
  • Ha elindul a dilivonat... Barcelonában 2019. márciusi szennyvíz-mintából sikerült (erősen gyaníthatóan fals) pozitívat kihozni. A kutatók 5 perccel "felfedezésük" után persze arra is rájöttek, hogy jó ez a kis médiahekknek is beillő reveláció, de azt sem árt majd hozzátenni, hogy "de nem tőlünk indult, mi ezzel nem azt mondjuk". Úgyhogy ezt rögtön hozzá is tették az eredményeikhez. Pedig ha annyira nyitottak a revizionizmusra, akkor miért ne lehetne akár nekiugrani a barcelonai élővilágnak? Vizsgálódjunk szabadon. Csak hát a józan észt ennyire nem vetkőzték le azért. Albert Bosch kutatásvezető nem átallotta azta mondani, hogy "sok a kínai Barcelonában", lehetséges magyarázatot sejtetőleg. Kedvenc kommentem a Twitterről: "Con esa basura de herramienta que es la PCR que usan para comprobar el virus sarscov2 van a encontrar este bicho hasta en muestras del pleistoceno". 
  • Másik kedvenc kommentem a témában: "El coronavirus es catalán", ami a spanyol (kasztíliai) kontextusban különösen ironikusan hat.
  • A sajtó ügyeletes idiótái persze most majd leírják kijelentő módban, hogy a vírus "már tavaly márciusban itt volt". 
  • A vírus szerkezetéről. Az RxxR furin hasítási hely itt RRAR, és ennek a papernek a szerzői in vitro azt tapasztalták, hogy a balról második R nélkül a furin általi hasítás nem működik jól. Vagyis ez egy funkcionálisan optimalizáltan jól működő szerkezeti alegység. Ez a tanulmány viszont arra jut, hogy a furin fontos, de a TMPRSS2 (transzmembrán szerin proteáz 2-es) általi hasíthatóság is fontos, és mindkettőre szükség van, ami feltételessé teszi a furin hasítási hely jelentőségét.
  • A strandolásról. Kedves sajtó! Kicsit azért szabad gondolkodni. Nem a parton heverészéstől fog megfertőződni a kedves fürdőző. Nem is attól, hogy a következő család másfél vagy két méterre van-e tőle a parton, szellős kültéren. Akkor fertőződnek meg, amikor mennek harapni vagy inni valamit. Vagy éppen mosdót használni. Sorban állnak, tömeggel vegyülnek. Kézmosás nélkül összefogdosnak dolgokat. És persze nem mindegy, hogy egy háztartás tagjai vagy több háztartás tagjai mennek-e együtt a partra, mert az utóbbi esetben a keveredésük is a terjedés útja lehet.
  • A nem-házhozszállítós/helybeni éttermi költés és a koronavírus-esetszámok növekedésének összefüggése a JPMorgan elemzésében (Egyesült Államok).
  • Az új magyar tesztelési politika a régire vált vissza, mintha nem lenne tegnap, amiből bármit tanulhattunk volna. Ismert fertőzött kontaktod van-e? Tüneteket mutatsz-e? Ha nem, akkor nem vagy tesztelhető. Csakhogy ezt a betegséget gyakran preszimptomatikusan, 1-2 nappal az onset előtt álló emberek terjesztik — innentől így csak a kapcsolatkövetéssel integrált pro-aktív tesztelés menthetné a helyzetet, ha jön a második hullám, és ezúttal kevésbé szerencsésen alakulnak a dolgok.  
  • Egy jó interjú arról (Kucsera Csaba szociológussal), miért nagyon gáz differenciálatlanul "idősözni" a koronavírus-járvány kontextusában, úgy, ahogyan az jellemzően történik. 

2020.06.29-30.

  • Michigani étterem, ahonnét villámgyorsan szétterjedt a koronavírus. Michigani bár, ahol megtörtént ugyanez. Ilyen "hatékonysághoz" talán a személyzet fertőzöttsége és a légkondi is szükséges lehetett, megkockáztatom (ottani viszonylatban meleg van most arrafelé).
  • A barcelonai "pozitív" eredményről közben megtudtam, hogy negatív kontroll nélkül végezték; egy vizsgálatra elég mintájuk volt fagyasztott szennyvízből, amit ezzel el is használtak; az eredményük pedig késői (39. ciklusban történt!) amplifikáció volt az RdRp-t kódoló génre (IP2 és IP4), amelyik a legkevésbé megbízható teszt valódi pozitivitás tekintetében (specificity), és ezért korroborációnak az E génre pozitív teszt elvárt általános protokoll szerint (és az itt negatív eredményt hozott). Tegyük hozzá, hogy ezen kívül már "csak" a józan ész szól az ellen, hogy Barcelonában 2019. márciusában SARS-járvány lett volna. Az, hogy egy ilyen eredménnyel a médiához rohantak az egyetemi sajtósok... Inkább nem is kommentálom. Aki akarja, érti.
  • Van némi izgalom a poliooltás immunstimuláns (nem-specifikus) használatával kapcsolatban (a koronavírus elleni védekezésként), csak hát a polio kapcsán elég hosszú a memóriám, hogy Szíriából emlékezzek a cVDPV (circulating vaccine-derived poliovirus) okozta járványos megbetegedésekre néhány évvel ez előttről. Ez a beoltott személyekkel kapcsolatba kerülő átoltatlan népességre jelent veszélyt.
  • Nálunk a "bemeneti" CFR (halottak / összes, eddig felderített eset) közben 14,02% a reggeli adatok beérkezte előtt. Az új adatokkal 14,11%, miután négyen meghaltak, és csak három új esetet sikerült találni. Ehhez tegyük hozzá, hogy a halálozás kb. háromhetes késést tartalmazó indikátor, és látszik, hogy baj van a felderítéssel. Márpedig csak a felderítés alapján tudhatnánk időben, ha baj van. (Ha valaki a bemeneti CFR terminuson töri a fejét, a kimeneti nálam a halottak / halottak+gyógyultak arány, vagyis a lezárt eseteken belüli arány, ami most 17,8% nálunk).
  • A Vox anyaga a rendőri militarizációról az Egyesült Államokban, így többek között az 1990-ből eredő 1033-as program szerepéről is, amivel a katonaság által leselejtezett eszközöket (gépkarabélyokat, aknabiztos járműveket stb.) beszerezheti az alsó-bölényfalvi rendőri erő is. Mindez a közelmúlt robbanásában nagy szerepet játszott, értelemszerűen.
  • Most már biztosabban lehet tudni: Bálint György, azaz "Bálint gazda" koronavírusos volt. Három teszt kellett, míg lett egy pozitív eredménye, ami kérdéseket vet fel bennem a teszt szenzitivitásának esetlegesen kritikusan rossz voltát illetően — és hogy ez mennyire befolyásolja náluk a járványügyi felderítést úgy általában, látva a már említett, felszökőben lévő CFR-t. Közben a mintavétel is lehet persze rossz, ha nem elég gondosan csinálják, például mert nem elég jók az eszközök hozzá. Éppen a napokban láttam a tévében olyan mintavételt, ahol a szájpadlásról gyűjtöttek hozzá egy kis nyálat törletnek, ami sajnos nem igazán eredményes módszer.
  • Hörcsögös tanulmány. A maszkviselés véd. Előbb másokat, de még a felhasználót is. De azért legyünk rá felkészülve, hogy akár idősebb embereknek is el kellhet magyaráznunk, hogy ha maszkot viselünk a jelenlétükben, az nem azt jelenti, hogy "mi jobban félünk, mint ők", hanem hogy legelőször is őket védjük ezzel magunktól. Mi tőlük pedig kevésbé leszünk megvédve, mint ők tőlünk. Úgyhogy ne aggódjanak, mi bátrak vagyunk. Személyes élmény alapján...

sarscov2_hamsters.jpg

  • Az EU az amerikaiaknak nem tervezni megnyitni a határait július 1-től. Közegészségügyi szempontból csak azt lehet mondani, hogy szerencsére. 
  • Alakulóban a lista még, így néz ki a BBC szerint mostAlgeria, Australia, Canada, Georgia, Japan, Montenegro, Morocco, New Zealand, Rwanda, Serbia, South Korea, Thailand, Tunisia and Uruguay. Algériánál, Marokkónál nyilván a francia befolyás segíthetett, hogy beférjenek, mert azért ideálisnak nem nevezhető a helyzetük. De ha már itt tartunk, Kanadáé sem. És Ausztrália sem kifejezetten "biztonságos" annyira. De persze Európa sem az. A listáról QMV-döntés születik (országok 55+%-a, a népesség 65+%-ával). A demokráciadeficit szó itt azért eszembe jut. A BBC szerint a németek és a spanyolok óvatosak akartak lenni (a németekről elhiszem), a görögök és a portugálok viszont nem annyira (turizmusérdek). Halkan megjegyzem, hogy aranystenderd tekintetében a beutazási kockázat menedzselésénél valószínűségekből kell kiindulni, és népességarányosan nézni a fertőzöttség előfordulását (aktív esetek százezer főre). Ha a menedzselés, azaz nem az elkerülés a cél. Itt, úgy tűnik, ez a helyzet.
  • Megint a Voxtól. Miért van annyi fülöp-szigeteki ápoló az Egyesült Államokban? Hogyan alakult ki az ehhez kapcsolódó migrációs csatorna, a maga push és pull tényezőivel, stakeholdereivel. Adat innen: 2018-ban 141 ezer fülöp-szigeteki ápoló volt az USA-ban, 371 ezer további külföldi születésű ápoló máshonnan. A COVID-válságban májusig harmincan haltak meg közülük.
  • Kínában átment a nemzetbiztonsági törvény, ami annyira nemzetbiztonsági, hogy ez alapján még nemzetbiztonságot is lehet majd tanítani hongkongi iskolásoknak.
  • Új H1N1 a láthatáron?
  • Narendra Modi létrehozta a PM Cares pénzügyi alapot Indiában (Prime Minister's Citizen Assistance and Relief in Emergency Situations). Látszólag az amerikai mintára, ahol van a gazdasági segítségnyújtáshoz egyének és vállalatok számára a Coronavirus Aid, Relief, and Economic Security Act, azaz a CARES Act. Csak ez itt "PM Cares", és ez így a szokásos "a politikusbácsi (a te pénzedből) szeret téged, törődik veled" című sláger lenyomása is, amit máig megdöbbentő lelkesedéssel zabálnak az emberek világszerte.
  • Ma (06.30.) 10 új fertőzöttet találtak Magyarországon, és itt van mellé ez a hír: 10 váci kézilabdázó pozitív. Az van, kedves honfitársaim, hogy ez a 10 ember kapta valakitől a fertőzést. Lehet, hogy az intézményeink úgy érzik, a munkájuk el van végezve, de kérdezném, hogy egészen komolyan a sportolók jelentik azt a populációt, amelyet fokozottan kívánunk védeni másokhoz képest...?
  • Újabb példa a járvány rejtett áldozataira. Egy ópioidfüggő hölgy halála az Egyesült Államokban, aki a tanácsadás és a gyógykezelés elmaradása miatt esett vissza, és halt meg, vélhetően fentaniltúladagolásban. G.a.h.: +163192+n.

Holnaptól új bejegyzésben folytatom!

28 komment

A koronavírus-járvány a lazítások után II.

2020.06.01. 21:07 :: Marton Péter

Előzmények (korábbi kutatási jegyzeteim a témában):

2020.06.02.

  • Tüdőátültetés koronavírusra pozitív betegnél, aki már hosszabb ideje ecmós/műtüdős kezelésen volt, magyar orvos csinálta, Lang György, de Klagenfurtban Bécsben, amúgy a világon először (víruspozitív betegnél). Erről a műtétről remélem, hamarosan részletesen is olvashatunk. Gratulálunk!
  • John Oliver — a voting-by-mail és általában a szavazás kihívásairól, koronavírus idején. Az az igazság, hogy JO vicces, mint általában, de itt az elemzés nem tökéletes. A csalások lehetőségét pl. egyének szempontjából nézi, miközben az ilyesmi szervezett politikai bűnözés részeként valósulhat meg elsősorban.
  • Arról, hogyan "épül föl" egy "látványos" gazdasági mentőcsomag.
  • A Twin Cities Riots kapcsán komolyan elszabadulóban az őrület. Sok az erőszakos eset, erőszakos rendőrök, erőszakos tüntetők, erőszakos ellentüntetők mind vannak, és persze az interneten is mindenki mindent megtesz az aktivizmus jegyében, ami elképzelhető, a milíciaszcénára épülő szélsőjobbtól a szélsőbal Antifáig. A karanténból eleve frusztráltan, sok esetben állástalanul kitörni készülő embereket sikerült jól felhergelni, a minneapolisi rendőrök lángra lobbantották a parázsló tüzet. Louisville-ben, Kentuckyban a rendőröknek sikerült megint teljesen értelmetlenül megölniük valakit, véletlenül fekete-amerikai az illető. És ebben még a Nemzeti Gárda is benne volt. Washington, D.C.-ben egy ausztrál stáb operatőrét ütötte meg egy rohamrendőr ököllel az immár megszokott, rendkívül szakszerű intézkedés jegyében.
  • Ha lenne oltás, tízből heten adatnák be maguknak (USA). Ha republikánusokról beszélünk, akkor csak tízből hatan. Jut eszembe, milyen szuper lesz, amennyiben lesz egyáltalán oltás, most már nem egy, hanem két szezonális oltásra befizetni évente. A "just the flu" tábor erről vajon mit gondol? "Just another flu?"
  • A KKP stratégiája szempontjából jó időzítéssel jelentkező koronavírusos klaszter Hongkongban, lehet korlátozni a gyülekezés lehetőségét a social distancing jegyében.
  • Minnesotából is hallottam egyébként olyat, hogy a tüntetéseken őrizetbe vetteknél "kapcsolatkutatást" csináltak, volt képük konkrétan contact-tracingnek leírni és eü. indoklást adni hozzá.
  • Ismét vissza Kínához. Az AP által megszerzett belső információk szerint a WHO is éppen eléggé frusztrált volt a kínai együttműködési készség korlátaival januárban, a járvány elején. (Itt az AP cikke is.) Többek között a vírusgenom megosztása sem zajlott olyan készségesen, mint azt utóbb többek beállították.
  • Az első megerősített koronavírusos haláleset Cox's Bazarban, a rohingja menekültek között Bangladesben.

2020.06.03.

  • Törökországban jók az eredmények a hidroxiklorokinnal, és, ami nagyon fontos, a HXQ-t korai kezelésként adják, hiszen vírusreplikáció ellen való, és ezt a kiterjedt és gyors tesztelésük és kapcsolatkövető munkájuk teszi lehetővé. 
  • Újabb hangok a tudomány világából, akik a SARS-CoV-2 eredetét firtatják, alapvetően már korábban tárgyalt okokból (emlékeztetőül: filogenetikai rendetlenség, furcsa pontmutációs mintázat az RaTG-13-as denevér-koronavírussal összevetésben, időarányosan csekély genetikai polimorfizmus a SARS-CoV-1-essel összevetésben; miközben az E protein ezzel együtt is szignifikánsan mutálódik a 0%-os baseline-különbséghez képest az RaTG-13-assal összevetésben; a patogenitást kritikus mértékben fokozó furin hasítási hely beszúródása; a vírus eleve adott jó adaptálódottsága nyérceknél és vadászmenyéteknél (is) + hogy egy ilyen vírus pont Wuhanból indul).
  • Most láttam adatokat a német, brit, olasz és amerikai mobilitási adatokról. A németek 34%-kal az alapvonal-érték felett, az Egyesült Államok 8%-on, az olaszok -11%-on, a britek -22%-on (a hétközi cikluscsúcson).
  • Egy olasz orvos, Alberto Zangrillo, a milánói San Raffele kórház főorvosa bedobta a diskurzusba, hogy a koronavírus veszít a virulenciájából, és már nem mérnek olyan vírusszámokat, mint korábban, a teszteltek mintáiban. Ez nagyon érdekes, csak az a probléma, hogy akik világszinten nézik a járványt, mint pl. én, nem látnak ilyesmit az adatokban. A SARS-CoV-2 terjed és öl továbbra is, meleg éghajlaton is.
  • Oroszországban a koronavírus-osztályokon nyitva felejtett kórházi ablakok közegészségügyi fenyegetése fokozódik, ez már a negyedik eset. G.a.h.: +75049+n.
  • Hu Weifeng 42 éves urológus orvos Wuhanból (Li Wenliang kollégája volt) négy hónapi kezelés után hunyt el. Még áprilisban agyi vérömleny keletkezett nála, azóta kómában volt.
  • Orosz és kínai részről a szokásos wedge-driving (éket verő) stratégiát nyomatják a társadalmi médián keresztül az Egyesült Államokban a Twin Cities Riots kapcsán.
  • Akik ennek a vírusnak a kontextusában "V-shaped recovery"-t (VSR) emlegettek, eddig jellemzően a gazdaság talpra állásáról beszéltek, méghozzá optimistán. Iránban a járványügyi lazítások után látható mostanra egy perfekt VSR, csakhogy ez itt sajnos a vírus terjedésére vonatkozik :(
  • Apropó, gazdaság: a Világbank előrejelzése szerint a globális szegénység nőni fog a koronavírus-recesszió miatt, az ázsiai pénzügyi válság óta először, 8,2-ről 8,6%-ra. Plusz 30+ millió ember, akik napi 1,9 dollár alatt élnének majd, ezek szerint.
  • Egy in silico tanulmány, szóval várni kell, mielőtt bárhová ugrik ez alapján az ember (ahogyan korábban a SARS-CoV-2 porfirinhoz kötődéséről szólónál is), de ha bejön, ami itt kijött, átnevezem a SARS-CoV-2-t a humán jackpot vírusnak. A furin hasítási hely már eddig is komoly érdeklődés tárgya volt, de a tetejében ennek a szerkezete — (P)RRAR--SVAS — egyezni látszik a humán epitheliális sejtek nátriumcsatorna alfa-alegységének (ez is egy transzmembrán protein, mint az ACE2) furin által hasított részével (ENaC-α; RRAR--SVAS szekvenciával). Ha ez így van élő sejtekben is, akkor ez plusz egy kellemetlen betegségmechanizmus lehet, mivel ez a sejtek sóháztartását zavarja meg.
  • A furin hasítási helynek egyébként már beceneve is van az amerikai diskurzusban: "the new hanging chad". Ez visszautalás a 2000-es elnökválasztás során Floridában történtekre. Akkoriban ott lyuggatókártyás voksolást használtak, és, ahogyan a BKV-jegyeken is előfordul, a lyuggatás nem sikerült mindig tökéletesen. Sokszor nem. A "chad", vagyis a lyukfecni, hogy erre kifejezést rögtönözzek, lóghatott a lyuk szélétől egy el nem szakadt ponton ("hanging chad"), vagy éppen a papír domborulatából látszott, hogy ott alighanem át kellett volna ütnie a gépnek a papírt a választó akarata szerint ("pregnant chad"). Márpedig a 2000-es floridai egy olyan választás volt, amin az egész elnökválasztás állt vagy bukott Al Gore szempontjából (it was hanging in the air...). Ám a Legfelsőbb Bíróság végül leállította a floridai szavazatok újraszámlálását, és így ifj. Bush vitte el a floridai elektorokat anélkül, hogy az újraszámlálás végeredménye alapján tudnánk, hogyan befolyásolták a lógós lyukfecnik az eredményt. Ezek után érthető lehet, hogy a kifejezés a SARS-CoV-2 eredetével kapcsolatos kételyekre utal.

2020.06.04.

  • Ezt már akartam linkelni korábban, Anders Tegnell félig-meddig beismerte, hogy tévedett. Ebben-abban. A helyzet az, hogy Svédország egymagában is sokat tett a járványhelyzet világszintű romlásáért. Persze messze nem minden rajtuk múlott, de a hatásuk világszintű volt.
  • Dr. Hansen George Floyd haláláról, precízen. (Közben kiderült egyébként, hogy még áprilisban átesett a koronavíruson. Az orrából vett post-mortem minta pozitív. Viszont már április 3-án pozitív volt, szóval itt csak a vírus-RNS-töredékek kimutatásáról van szó, nem aktív fertőzésről.)
  • Egy videó a tüntetésekkel párhuzamosan zajló fosztogatásokról. Azt érdemes látni, hogy a kereskedőnek ez rossz, de a márkák nyernek rajta, baromi jó reklám nekik, és ez is állandósít egy állapotot, ahol oktatás és egyéb befektetések helyett a surranók lesznek magasabbra értékeltek jelentős tömegek által. A surranók beszerzését (is) megnehezítő, és ezeket annál értékesebbé emelő jövedelmi különbségekről (az Egyesült Államokban) érdemes megnézni ezt a rövid dokut. A békés tüntetéseket hiányolók pedig nem ártana, ha belátnák, hogy csak azért, mert ki tudják keresni a legdurvább híreket, amik az előfeltevéseikben megerősítik őket, most is békés a tüntetések nagyobb része. De ha már békés tüntetésekről beszélünk, érdemes visszanézni, hogyan reagált Donald Trump a fekete NFL-játékosok békés tüntetésére 2016-ban — hogy mennyire hisz ez az ember a szólásszabadságban. Leginkább a saját szólásszabadságában hisz, elvei nyilvánvalóan nincsenek.
  • Mexikóban tegnap 1092-en haltak meg hivatalosan COVID-19-ben. 
  • Nálunk 406 beteget ápolnak közben kórházban. Húsz százalékos hospitalizációs rátából kivetítve az 2030 aktív esetet jelenthet, bár ez erősen bizonytalan, mert aki enyhén beteg, 5-10 nap alatt túl lehet rajta, a kórházba kerülők pedig sokáig ott maradhatnak, kezelésre szorulva. A 13,63%-os CFR-t torznak feltételezve, 2%-os CFR-ből kiindulva 26950 jön ki teljes esetszámként, amiben már lezárult esetek is benne vannak úgy. 
  • A Reuters külön statisztikát vezet az Egyesült Királyságban elhunytakról, akiknél a halotti bizonyítvány említi a COVID-19-et. Ebben persze lehet olyan is, akinek a fejére esett egy tégla, miközben fertőzött volt. Így tartanak június 3-ig 50059-nél. Ezt a "téglás" esetekre tekintettel leviszem 49 ezerre, majd levonok belőle egy tizenkettedet, tekintettel arra, hogy szezonális átlagot meghaladó halálozást egy április közepi hétre már figyelembe vettem, és 12 hete van COVID-19-es halálozás az Egyesült Királyságban. Így jön ki akkor 44917 (ez konzervatív számítás, mivel az említett áprilisi hét valójában kiemelkedő halálozást hozott, nem átlagosat, a 12 hetes időszakot tekintve). Június 3-ig volt 39728 haláleset hivatalosan, a különbözet így 5189. G.a.h.: +80238+n. Ugyanez a cikk említ egyébként 62 ezres szezonális átlagot meghaladó halálozást erre az évre, lásd itt is és itt is. Utóbbi forrásból végre kiderül, hogy ez a március 21-től május 22-ig terjedő 9 hetes időszakra értendő. Ha ebből levonok 11854-et (április 11-17-es adat, amit ismertem korábban), akkor marad 50146. Ha ezek után az (50146-44917)/4 formulával számolok, extra konzervatívan (hogy a 44917-es érték lefelé becslő voltát tekintetbe vegyem, ami itt máskülönben inflálná a g.a.h. mutatót), akkor g.a.h.: +80238+1307+n=81545+n. 1000 bocs a sok számért — így lehet ennyi különféle adatból valami valósághoz közelit kihozni.
  • A prosztataműtéten átesett, vagy éppen a férfiasan kopasz férfiak és egyéb releváns alpopulációk vizsgálata alapján egyre jobban látszik az androgén hormonok és a rosszabb COVID-19-es mortalitás közötti összefüggés.
  • Moszkva, Dagesztán és Cseljabinszk után Szentpétervárról is vannak adatok a szezonális átlagot meghaladó halálozásról. Májusban +1400 haláleset az évtizedes átlaghoz képest. Hivatalosan csak 171 a halottak száma. Ha az 1400 felével nézem a különbözetet, akkor g.a.h.: +82074+n.
  • Úgy tűnik, sokan betegek hónapokig enyhénél rosszabb tünetekkel. Csoportjuk is van a Facebookon. Sokan fiatalok.

2020.06.05.

  • Új-Zéland lehet az első országok egyike (az első az OECD-országok közül), amelyik száznál több eset után eljuthat a járvány teljes felszámolásáig. Még van egy aktív esetük. Ha a dolog összejön, és végül a beutazás is lehetséges lesz, onnantól új típusú izgalmak kezdődnek.
  • Jemenben elapadóban a segély, elsősorban az Öböl-országok miatt, akik eddig a fő donorok voltak (érdekeltségükből adódóan szórtak a bombák mellé pénzt is Jemenre). Az OCHA (humanitárius ügyek hivatala, ENSZ) részéről így látják a dolgot: "General health services in 189 of the country's 369 hospitals start to close in three weeks. Water and sanitation services for 8.5 million people, including 3 million children, close in three weeks. Nutrition support for 2.5 million malnourished starving children will start to close in eight to 10 weeks."
  • A Lancetben megjelents HXQ-tanulmányt a Surgisphere cég bizarr és hozzáférhetetlen adataival visszavonták.
  • Magyarországon 16 új eset tegnap, 3 haláleset mellett. Emlékeztetőül: 2%-os valós CFR-t feltételezve azt, ha nálunk közben 13% feletti a nominális CFR (az összes regisztrált esetet tekintve), és tovább nő, csak úgy lehet értelmezni, hogy a járvány felderítetlensége is növekszik vele együtt. Az lehet, hogy nyáron kevesebb a súlyos eset, de erről jobb lenne biztosat tudni, és nem csak spekulálni, különösen az exponenciális növekedés lehetőségére tekintettel.
  • Törökország, kijárási korlátozások.
  • Trump 1990-ben lájkolta, amit a Tienanmen téren látott 1989-ben. A teljes releváns idézet: "A: (...) Russia is out of control and the leadership knows it. That’s my problem with Gorbachev. Not a firm enough hand. Q: You mean firm hand as in China? A: When the students poured into Tiananmen Square, the Chinese government almost blew it. Then they were vicious, they were horrible, but they put it down with strength. That shows you the power of strength." (Q=Question, A=Answer) A lelet talán legsokkolóbb vonatkozása, hogy ezek szerint tud következetes lenni.
  • A University of Minnesota kísérlete a HXQ post-exposure prophylaxisként történő használatával. Interneten át lehetett résztvevőnek beszállni, önbevallás alapján azonosított kitettség nyomán, önbevallás alapján azonosított, teszt útján meg nem erősített megbetegedésekben számolva az eredményt a kísérleti és a kontrollcsoportban (n=821). A kontrollok 14,3%-ban, a HXQ-t szedők 11,8%-ban betegedtek meg, ami statisztikailag nem szignifikáns. Csak sajnos ezzel a módszertannal semmi nem tud olyan nagyon szignifikáns lenni, az a bajom :( Ez így nem egy szabályos RCT.
  • A stroke és a neurológiai problémák diagnosztizálásának és kezelésének nehézségeiről COVID-nél. Reflexek és koordináció vizsgálata szedálásnál kizárva. MRI-re átvinni nem lehet csak úgy az intenzívről, ráadásul fertőzésveszélyhez vezet. A hordozható MRI épp oly jól jöhet, mint a tüdőnél a hordozható ultrahang. By the way, a cikk arra is kitér, hogy a lélegeztetőgépen leszedálva tartott betegek 70-75%-ánál delíriumos állapot léphet fel.

2020.06.06.

  • Ezt a threadet fogom itt feldolgozgatni. Nagyon érdekes gondolatmenetekkel a SARS-CoV-2 lehetséges eredetéről. A szót William Gallagher végzi (mikrobiológus). Az RaTG13 és a SARS-CoV-2 S-fehérjéjét nézi, a furin hasítási hellyel az S1/S2 funkcionálisegység-határon, és az azt kódoló nukleotidszekvenciát, 288 nukleotid hosszúságban. Miközben az aminosavszekvencia a furin hasítási helyet leszámítva egyezést mutat, a nukeotidszekvencia 19 pontmutációt tartalmaz kodonok ingatag pozíciójú (wobble-position) záró nukleotidjainál (6,6%-os eltérés). Ezek mutálódásának időigényét illetően Gallagher a H1N1 influenzavírus analógiáját veszi alapul, és az alapján végez tMRCA-elemzést (time to Most Recent Common Ancestor). Így jön ki a threadben némi korrekció után -38,5 év számítása szerint az RaTG13 és a SARS-CoV-2 közös elődjének, illetve az evolúciós szétválás pillanatának időbeli helyeként. Megjegyzés: túl azon, hogy a tMRCA becslésében vannak bizonytalanságok, szerény ismereteim alapján elég furánk tűnik nekem, hogy két eltérő RNS-vírusnál ilyen lazán azonos változás-időigényt feltételezzünk. Ha a koronavírus pl. lassabban mutálódik, akkor a 19 pontmutáció különbséget wobble positionöknél egy ekkora szakaszon hosszabb idő elteltével lehetne csak magyarázni... nem? (Módszertani megjegyzés: "The reliability of (tMRCA) analysis is dependent on the validity of the molecular clock hypothesis, which assumes that the evolutionary rate is roughly constant in the lineages of a phylogenetic tree".)
  • A 12 nuleotidos szekvencia a PRRA-beszúródás hátterében: CCTCGGCGGGCA (a T helyére U-t kell igazából képzelni, timin helyett uracilt, mivel ez RNS, nem DNS). Gallagher ezek után a Rousettus-repülőkutyákból/nagydenevérektől izolált HKU9-es denevér-CoV esetében talál hasonló szekvenciát egy résnyi hibával, amit egy copy-choice (másolási) hibával magyaráz, vagyis hogy egy sejtben, ahol egyszerre két különböző vírus replikálódott, a replikációhoz használt RNS-dependens RNS-polimeráz rosszul másolt, és így keveredett be egy elem máshonnan. Megjegyzés: színkóddal jelölöm az így magyarázott egyezést a furin hasítási helynél (zölddel), a furin hasítási helyen kívüli egyezést (sötétkékkel), pirossal egy elárvult adenint (A) a furin hasítási helyet kódoló szekvencia végén, és egy citozint a CTT kodon nyitó nuleotidjaként a SARS-CoV-2-nél, mert ennek fontos szerepe van.

HKU9 gcatttgtacaga------cctcggcgggcctctgt

CoV-2 tatcagactcagacttgctcctcggcgggcacgtagt

  • Az előző pont végén említett citozinnal együtt bekerül a szekvenciába egy palindróma: CAGAC (aláhúzva fent). Gallagher elmélete szerint ez idézte elő az RNS-polimeráz által elkövetett copy-choice hibát, és hogy az bemásolt egy ilyen, vagy nagyon hasonló, később csendesen mutálódott szakaszt a HKU9-ből (megj.: a GCC és a GCA is alanint kódol, tehát PRRA-t látunk a HKU9-esnél is). Alapvetően az RNS-polimeráz "dadogásáról" (stuttering) volna tehát szó ezek szerint.
  • Még egy megjegyzés: a furin hasítási hely a PRRAR szekvenciával teljes, tehát a beszúródáson túl van plusz egy arginin (R) ott. Azt CGT nuleotidszekvencia kódolja, úgyhogy ezt meg lilával jelölöm a SARS-CoV-2 nukleotidszekvenciájában.
  • A következő kritikus állítás ezek után az, hogy Jünnan tartományban, ahonnan az RaTG13-ast fellelték, a Rhinolophus affinis egy példányából (közepes termetű patkósorrú denevérből), a Rousettus-repülőkutyák/nagydenevérek is előfordulnak, és a két faj képviselői így gyakran osztoznak barlangi tereken. (A tobzoskákról hozzáteszi, hogy azok elég félős, magányos lények, úgyhogy messze nem ideális jelöltek rendszeres oda-vissza fertőződés lehetséges alanyaként denevérekkel.)
  • Következtetés: az a bizonyos "new hanging chad" még sok vitát fog szülni, mivel "Gallagher (denevérsejtekben) dadogó RNS-polimeráz elmélete" is csak egy további elmélet, a nap végén, a "nem-konszenzusos (furin hasítási helyet tartalmazó) mutáció emberi sejtekkel való találkozás nyomán történt konszenzusossá válásáról szóló" és a "furin hasítási helyet beillesztő wuhani gain-of-function kutatások szerepét firtató" másik két elmélet mellé.
  • Más témák. 2,5 millió új állás májusban az amerikai gazdaságban, kicsit csökkentette ez a munkanélküliség durva megugrását (amúgy az azért még mindig magas). Kieg.: hmm. Ott is szeretnek játszani az ilyen adatokkal. A fizetés nélkülire küldött dolgozókkal a munkanélküliség inkább 16%-os lehet (ezzel a bruttó/effektív munkanélküliségi mutatóval áprilisban 20% körül lehetett).
  • San Joséban (USA) egy közösségi aktivistát, aki a rendőrséget a rasszizmussal kapcsolatban érzékenyítő tréningeket tartott rendszeresen, rendőrruhában gumilövedékkel lövöldöző gyerekek úgy meglőtték igazi ok nélkül, hogy nem biztos, hogy lehet még gyereke. A történet másik "szívet melengető" momentuma az autós említése, aki azért tett ki "Blue Lives Matter" (="a rendőrök élete is számít") matricát az autójára, hogy ne büntessék meg gyorshajtásért.
  • Trump közben ilyen reakciókat kap katonai körökből, miután a katonaság bevetését ígérgette a tüntetések ellen.
  • A járvány miatti intenzív, megelőző jellegű antibiotikumhasználat elleni ajánlások, a mikrobiális rezisztencia fokozódását elkerülendő.
  • Oxigénhiány Peruban.
  • A napokban szó esett itt az androgén hormonok szerepéről, és a kopaszodásról, mint rizikót indikáló faktorról. Mint kiderül, ezt "Gabrin-jelnek" is hívják újabban (Gabrin sign), Frank Gabrin miatt, akinek a története itt olvasható. New York-i sürgősségis orvos volt, COVID-ben halt meg.
  • Oroszországban elhunyt egészségügyi dolgozók listája. Sokan vannak. Jelen állás szerint 363-an, ami azt jelenti, hogy a hivatalos orosz halálozási adatok... ööö... különösek. (A fő listát külön, másik listán a más országokban meghaltak, vélhetően orosz állampolgárok követik, Moldovából, Ukrajnából, külön a Luhanszki Népköztársaságból (ЛНР), Belaruszból, Kirgizisztánból, Kazahsztánból.) Hogy ebből gyorsan valami értelmező adatot is generáljak: 179-n voltak közöttük 60 év alattiak (azaz a 60 éveseket már nem számoltam ebbe bele). Nem csak a 60 alattiakat nézve: 56 volt köztük dagesztáni, 96 moszkvai, 31 szentéptervári, 57 Moszkva körzetéből (Московская область), Jaroszlavszkaja oblaszty: 4, Krasznodar és körzete: 7, Komiföld: 3, Szentpétervár körzete (Ленинградская область): 5, Ingusföld: 2, Csecsen Köztársaság: 7, Uljanovszk: 2, Kurszk és körzete: 9, Nyizsnij Novgorod: 5, Ivanovszkaja oblaszty: 2, Penza: 7, Rosztov-na-Donu: 1, Észak-Oszétia: 6, Tatársztán: 2, Tula: 3.
  • A fenti adatot a 60 év alattiakról érdemes átgondolni stratégiaian. Különösen ott, ahol nincs elég orvosi PPE, az eü. személyzet nagy valószínűséggel erős dózisban kapja a vírust a transzmissziónál, akár többször is, ismételten. A halálozási mutató így akár rosszabb is lehet az általános populációénál esetükben. Ha csak eü. dolgozókat veszítenénk el miatta, ezt a járványt már akkor is fontos lenne megfelelően kezelni :(
  • Immunológiai vizsgálatból már korábban felvetődött, hogy lehet némi keresztimmunitás a hagyományosan az emberi populációban keringő koronavírusokkal. Didier Raoult is erre jutott Franciaországban, méghozzá a gyerekek alacsonyabb fertőzöttségét próbálja magyarázni ezzel. Itt beszél erről Raoult maga, messzire jutó következtetésekkel, amelyeket egyelőre azért finoman szólva nem sikerült megalapozni empirikusan. Figyelmet viszont érdemel a dolog, az biztos. Kompartmentmodellezésben pl. mekkora az S populáció (Susceptibles)? Hány embert kell átoltani? Meddig adott keresztvédettség, ha adott? Stb.
  • Palkovics László egyiptomi megfelelője, Khalid Atef Abdul Ghaffar állítólag azt nyilatkozta, hogy Egyiptomban már 9000 felett a halottak száma, azaz jóval több, mint a laboratóriumi úton megerősített (akkori) 959. Várnék ennek a figyelembe vételével, mert a közlő az Anadolu Agency állami török hírügynökség, és Törökország és Egyiptom nincsenek jóban Líbia miatt — utóbbi Haftarékat támogatja, előbbi az ENSZ által elismert vezetést, az ottani polgárháborúban.

2020.06.07.

2020.06.08.

  • Itt ez a friss paper, az egyik szerzője Yuri Deigin, akiről már írtam korábban, a másik Rossana Segreto (Innsbrucki Egyetem). Ezt fogom ma feldolgozni először is. Ez a "laboratóriumi eredet" elméletből indul ki.
  • Először is, a "PRRA beszúródásról". Ha úgy nézzük, akkor nem illeszkedik "keretbe", vagyis nem pont egy nukleotidhármas kodon határától egy másik kodon határáig tart, közrefogva 4 kodont. Lásd alább:

sarscov2_insertionoutofframe.jpg

    • A következtetés az RaTG13-as denevér-CoV-val összevetésben adódik, és az M789-es pangolin-CoV-val történő összevetés is megerősíti. TCA (RNS-nél igazából UCA) kódol a keret előtt egy szerint (S). A végén az adeninből (a) viszont uracil lesz (t, azaz helyesen u) a SARS-CoV-2-nél. Az adenin (a), ha úgy tetszik, a PRRA-t kódoló keret másik határa elé került itt át. A beszúródott rész így "UCCUCGGCGGGC". Ez akkor magyarázza az elárvult adenint. És a beszúródás akkor csak végeredményben PRRA.
    • Az arginint (R) kódolhatja CGG, CGC, CGA és CGU is, és a SARS-CoV-2 és az RaTG13 esetében az előforduló arginineket érdekes módon csak az esetek 5%-ában kódolja CGG. Itt pedig mindjárt két ilyen is van egymás mellett, és ezt Deigin és Segreto különösnek látják.
    • És itt jön egy kritikus állítás: "The CGGCGG insert includes a FauI restriction site, of which there are six instances in CoV2 and four instances in  RaTG13 (and 2 in MP789). The serendipitous location of the FauI site could allow using restriction fragment length polymorphism (RFLP) techniques for cloning or screening for mutations, as the new furin site is prone to deletions in vitro." Megjegyzés: a CGGCGGG lehet, így, együtt figyelemre méltó szekvencia ilyen szempontból, azaz akkor, ha az említett restrikciós enzimmel tördeléshez (az eljárásról bővebben) felismerőhelyet keresünk. Hogy itt a megfelelő irányból olvasva van ilyen (GGGCG), éppen a furin hasítási helyet létrehozó beszúródásnál, az érdekes lehet, erre utal a szöveg "szerencsés együttállásként" kutatói szempontból. A mondat vége pedig arra, amit Vero-E6-os majom-sejtkultúrákban lehetett látni laboratóriumban, vagyis hogy az emberi szervezetben a vírusnak a cutting edge-et biztosító furin hasítási hely gyorsan törlődni hajlamos — emiatt praktikus, hogy a restrikciós enzimmel gyorsan lehet szűrni mutációkra.
    • Szó esett korábban az RmYN02 denevér-CoV-ról, ahol van egy "PAA" a genomban. Ezt beszúródásként írták le, azzal, hogy lám, az ilyesmi természetes, Deiginék viszont közlik a ZC45-ös denevér-CoV genomjának megfelelő szakaszát, ahol látszik, hogy a PAA ott nem beszúródás, hanem inkább nem-csendes pontmutációs változás. Lásd alább. Zölddel bekereteztem az egyező aminosav-szekvenciákat. Megjegyzés: megnéztem közben a ZC45-ös szekvenciáját, hogy lássam, mi jön a jobb végen, amit ez a szelvény nem mutat, és az látszik, hogy konkrétan az RmYN02-ben törlődés van. Nemhogy nincs benne beszúródás, de rövidebb. RmYN02: SYNSPAA------RVGTNSIIAYAM. ZC45: SYHTASIL----RSTSQKAIVAYTM. (A 6/4 helykihagyás abban, ahogy leírtam, azt mutatja, ahol a SARS-CoV-2-nél PRRA van.)

sarscov2_rmyn02covnoinsertionjustmutation.jpg

  • Egy érdekes további részlet Deiginéktől, korrektül hivatkozva, szakfolyóiratban is meg lett írva annak idején. Az RaTG13 olyan bányából származott Tongguanzhenből (Mojiang, Yunnan; alternatív átírásban: Tian Junhua), amelyet denevérek kolonizáltak, majd a velük együtt a nyomaik (denevérguanó) kitakarítására odarendelt bányászok közül hatan súlyos tüdőgyulladást kaptak, és hárman meghaltak.Ez 2012-ben történt. Amit a kutatók az esetek kórokozójának találtak, az egy paramyxovírus volt, MojV (Mojiang paramyxovirus) néven regisztrálták. De ugyanonnan előkerült egy csomó denevér-koronavírus is, köztük — 2013-ban — az RaTG13 is. De a legérdekesebb, hogy a bányászok közül négynél (!) volt SARS-IgG-antitest, illetve olyan antitest, ami legalábbis kereszt-reagált a SARS-antitestvizsgálatnál... Ez alighanem nyomós ok volt a kutatócsoport maradására az MojV azonosítása után is. Egyáltalán: biztosak voltak ők a MojV-t illetően, ha SARS-antitestvizsgálatra is időt fordítottak? Kétlem. Talán pont ezért maradtak. (Emlékeztetőül: az IgG az IgM után jelenik meg, vagyis múltbéli fertőzést jelez.) Kieg.: ebben a cikkben, amelyikhez Shiéket is megkérdezték, a denevérguanó borította helyeken előforduló gombához kötik a mojiangi bányászok tüdőgyulladását. Ez a következetlenség nem kicsit megdöbbentő, a korábban említett publikáció nyomán. Hogy lett a MojV helyében egy fungus a gyanúsított? Eleve nem volt komoly bizonyíték a MojV mellett? 
  • Más dolgok innentől. Az Egyesült Államokban a rendőrség sajátos kultúrájáról minden karikírozás mellett is jó adalékokkal John Oliver. 2014-ből pedig Jon Stewart teljesen ugyanerről. Persze, a rendőrség az Egyesült Államokban decentralizált, tudom. És voltak letérdelő rendőrök, tiltakozók stb. De a rendőri kultúra amúgy meglehetősen homogén. San Franciscóban vettem részt egyszer az ott rögtönzött kiállítás látogatójaként, még 2013-ban, a nyitott érdeklődés jegyében egy rendőri demonstráción, ahol egyrészt szomorú dolgokat láttam, mivel egy olyan országban, ahol sok a lőfegyver, bizony, sok rendőr meghal szolgálat közben, és erősen érthető, ha ezt a rendőrök kemény stresszként élik meg. Másrészt viszont letaglózóan pátoszos légköre volt az eseménynek, az volt a szubjektív benyomásom. A szervezők szentnek láttatták magukat egy bűnös vagy éppen a szolgálatukra nem eléggé méltó társadalom ellenében, és ez a szemlélet hosszú távon biztosan nem egészséges... Még egy adalékot ehhez: Eric Garner halála után nem volt a mostanihoz hasonlóan nagy robbanás, és ennek nyilván számos tényezője lehet. A most zajló járvány, és az azt megelőző lockdown és elbocsátás-hullám biztosan ezek között van.
  • Lengyelországban lett a hétvégén lazán 1100+ fertőzés. Ehhez a szénbányához köthetők (Zofiówka). Klaszterek környékünkön. Nálunk ilyen biztosan nem történhet...?
  • Most már általában is ajánlja a WHO a maszkviselést. Korábban csak beteget gondozóknak és beteg személyeknek ajánlotta. Nem siették el.

2020.06.09.

  • Nicaragua. Hát, kijelenthetjük, hogy a járvánnyal kapcsolatos hivatalos halálozás duplázódási idejének növekedésében most már a korrupt/hülye kormányzatok is komoly mennyiségi tényezőként számítanak. Valóságtagadó vezetés, és minimum 980 atipikus pneumóniás haláleset (köztük vezetők is szép számmal), a hivatalos 46 COVID-19-es helyett. G.a.h.: +83010+n.
  • Ez a járvány a legcsökönyösebb elemzőt is alázatra tanítja. Lehet, hogy kénytelen leszek revideálni a járvány októberi kezdetének lehetőségét? Indirekt indikátorok wuhani magatartás-változási mintázatokról, tavalyrül. Nézzük részletesen. Kórházi forgalom a környéken parkoló autókban mérve, műholdas képek alapján:

sarscov2_hospitaltraffic_wuhan.jpg

  • Az októberi vonalat én húztam be, hogy érzékelhető legyen, a szezonális átlagtól való eltérés már akkor határozott volt, ezek szerint (108 dél körül, tiszta ég mellett készült kép alapján, kereskedelmi műholdas szolgáltatótól). Nyilván végig kell majd olvasnom a tanulmányt, preprintként meglesz.
  • Közben viszont nem egyértelmű a kép más indikátorokat tekintve. Íme, az internetes keresések. A légúti és hasi panaszok együtt-járása decemberben annak ellenére kiváltott nagyobb érdeklődést az internetezőknél, hogy hivatalosan még nem volt semmi. Tehát decemberben, és nem októberben, és ez azért is figyelemre méltó, mert kontrollnak közben ott van, hogy a szezonális influenza mennyi keresést vált ki általában. Az ábra jobb oldalán a "May 2019" alighanem "May 2020" akart lenni.

sarscov2_internetsearchtrendswuhan.jpg

  • Itt a teljes tanulmány akkor. Kicsit túlterhelt a szerver, lassú lehet letölteni :)
  • Az egyik legérdekesebb dolog kimaradt a fent idézett sajtóbeszámolóból. Ebből is az derül ki, hogy a kép nem egyértelmű, pontosabban a kórházak közelében parkoló autók egyelőre magányos indikátort jelentenek. A nem egészen pontosan tisztázott eredetű kínai kórházi betegadatok ugyanis csak november elejétől jeleznek ugrást "influenzaszerű" esetekben. Akkor viszont nagyon, 2017/2018 és 2018/2019 teléhez képest, tehát akkor 2019. november eleje lehet a járvány indulása ténylegesen — és ez, ismerve a november 25-én megbetegedett Connor Reed esetét, illetve egy, kínai források által említett november 17-én kórházba került esetet, plauzibilis. Szó szerint így írja le a forrást a tanulmány: "Three yearly influenza-like-illness cycles (c, turquoise, right side axis) from two Wuhan hospitals plotted alongside confirmed COVID-19 case counts (c, purple, left side axis) extracted from open-source disease data." Az adatok alább.

sarscov2_harvardstudy_diseasesignal.jpg

  • Ha a kórházakban nem volt több járványos beteg, akkor hogyan függene össze ilyesmivel az autóparkolói forgalom visszaesése...? Szóval én egyelőre úgy látom, hogy a tanulmány lelete nem forradalmi, bár érdekes, és később még visszatérhetünk rá. Mindenesetre a saját három indikátorukból kettő nem októberi kezdetre utal. 
  • Új forrás tárgyalása innentől. A mai egy zsúfolt nap lesz, már látom. Itt a következő izgalmas gondolatmenet, amit meg lehet nézni részletesen (Matt Ridley).
  • Mond pár meggondolatlanságot, megalapozatlanságot arról, hogy a SARS-CoV-2 CFR-je 0,28% alatt lenne, amit azért nehéz az adatokból pókerarccal levonni. Ugyancsak alaptalan a "május óta politikától függetlenül mindenhol visszavonulóban a vírus" kijelentés, nem is értem, miért nehéz megnézni az adatok tényleges állását. Azt ugyanis (nem "visszavonulást", hanem lassulást) a szezonalitásnál jobban magyarázza a kijárási és a nemzetközi utazási korlátozások impaktja, az eredményesebbé váló kórházi kezelési protokoll, vagy pl. globális szinten a hazug és a gyenge kapacitású kormányzatok adatokkal kapcsolatos tevékenysége.
  • Nagyon érdekes viszont — és hihető — az elmélet arról, hogy az 1889/1890-es, észlelés szintjén Oroszországból indult járvány hátterében az OC43-as koronavírus állhatott (itt az erre jutó tanulmány 2005-ből). Erre a vírusra már korábban is utaltam itt úgy, mint "most underreported pathogen ever", és pedzegettem, hogy az éves influenzahalálozási projekciók valószínűleg a koronavírusok, talán éppen az OC43-as "kárára" csalnak.
  • És az is bizonyos, hogy a számos országban bevezetett kijárási korlátozások szelekciós nyomásként jelentkező környezeti változást hoztak a vírus számára. Ellentétben Ridley-vel, én azt gondolom, hogy a szelekciós nyomás első következménye a hosszabb lappangási idő, de amellett az erősődő átadhatóság és ugyanakkor a korlátozott virulencia is lehet implikáció. Így tud a vírus nehezebb körülmények Szóval pont az ellenkezője lehet a tényleges következmény annak, amit ő hipotetizál az írása végén.
  • Ami pedig a keresztimmunitást illeti, valamennyi lehet, igen. Nem biztos, hogy szeretnénk kipróbálni, hogy mennyi, a populáció szintjén, de azért lesz, akit ez ment meg (illetve lehet, hogy van, akit ez már megmentett). És hozzátenném, hogy fertőződéstől túl sokakat nem véd meg, mert ahhoz túl sok klasztert láttunk közel-teljes átfertőződéssel, ugyebár.
  • Más dolgok. Tudjuk, mit (nem) csinálnának az amerikai epidemiológusok idén nyáron (n=511). Persze náluk mások/rosszabbak a trendek és a helyzet, mint nálunk (amennyire ez megítélhető, most). Beltéri baráti találkozóra (small dinner party) 46% 3-12 hónap múlva menne (ez nyilván értekezletekre is értelmezhető, pláne ha van az asztalon pogi); 40% 3-12 hónap múlva tömegközlekedne; 54% 3-12 hó múltán dolgozna közös irodában kollégával/kollégákkal; 56% 3-12 hó múlva enne helyben étteremben; 42% temetésre vagy esküvőre csak egy év múltán menne (ez az, ami az átlagos embernek fel sem nagyon vetődik megfontolás tárgyaként); 64% egy év múltán menne tömegrendezvényre (event, concert or play); 52% egy év múlva fontolná meg a maszkhasználat mellőzését.
  • Böröcz József az "európai" "jóság" és "fölény" konstrukciójának hosszú ideje leleplezője és kritikusa, és most a járvány kontextusában pedzegeti, hogyan hathat ebből a szempontból pl. Kelet-Európa egyelőre jobb helyzete.
  • Dél-Korea: új klaszterek, az egyik pl. egy asztalitenisz-klubban. Biztosak vagyunk benne, hogy ilyen nálunk nem történhet...?
  • A lombardiai járvány epidemiológiai elemzése a cogodnoi kezdetektől (januártól). Nem volt sok aszimptomatikus hordozó, és kb. ugyanakkora volt náluk a vírusszám, mint a szimptomatikusaknál (vagyis az ereiket nekik is rombolta a vírus bőven). 47% került kórházba, 16% került intenzív osztályra 5626 elemzett páciensből. Férfiak többségben. 25 év felett a nagy többség (94 nem). A lombardiai eü. rendszerről sokat elmond, hogy 55 év alatt ezek között a páciensek között nem volt halott.
  • COVID-19-es és influenzás elhunytak tüdejének összehasonlítása. Utóbbiak tüdejének nagyobb volt pl. a súlya. Az ACE2-kifejező sejtek aránya magasabb volt a COVID-osoknál, de az influenzásoknál is meghaladta a kontrollcsoportos tüdőkét. Itt is előjön az angiogenezis a léghólyagocskák körüli kapillárisoknál. "Intussusceptive angiogenesis" =  belülről induló érképződés. Az influenzásoknál ilyen nem volt. Ábra is van róla, íme:

sarscov2_intussusceptiveangiogenesis.jpg

  • És itt egy fontos tanulmány (Imperial College London) arról, mennyi életet menthettek meg a kijárási korlátozások. 3,1 millió haláleset elkerülve Európában (fentebb a lombardiai tanulmány is erre jutott egyébként, tehát hogy a gyors korlátozások mentették a helyzetet a vereség kapujából). Persze ez csak egy módszeres projekció, de mindenképpen érdemi válasz a prevenciós paradoxonra, amikor emberek azt hiszik, "nem haltak meg sokan, tehát nem is volt szükség prevencióra".
  • És egy szuper ábra, ahol látszik a furin működése a Golgi-készülékben.
  • Klaszter Dél-Bulgáriában, egy játékgyár alkalmazottai. Nálunk ilyen biztosan nem történhet...?

2020.06.10.

  • Brazíliában vissza kell térni a korábbi, teljes körű adatszolgáltatáshoz, az ottani Legfelsőbb Bíróság bírájának döntése.
  • A járványról Skóciában, epidemiológiai szempontból, preprint. Területi evolúció szempontjából érdekes, hogy nem a Glasgow-Edinburgh tengely volt az első közvetlenül érintett rész (az első eset olaszból jött, rögbimeccsről, haza Tayside-ba); a hálózatelemzés pedig azt valószínűsítené hipotetikusan. Géntérkép: elég elterjedt nem-csendes pontmutáció az S-fehérjét kódoló szakaszban, az izolált vírusok enyhe többségénél (a Wuhan-Hu-1-eshez képest).
  • Vírusreplikáció különféle szövetekben, in vitro és ex vivo. A szem-kötőhártyával kapcsolatban a legérdekesebbek az eredmények. Lehet a szemen át fertőződni.
  • Egy koreai call-centeres klaszter. 43,5% lefertőződött egy emeleten, csak 1,9% maradt aszimptomatikus közülük. Megkockáztatom, hogy a légkondinak volt szerepe.
  • Továbbképzéshez: a furin szerepéről proprotein konvertázként. Tanulságos, hogy 2002-es cikk, és egyből belecsap a lecsóba, a biohadviselési/bioterror applikáció lehetőségét említve. Azért is jó a cikk, mert világosan leírja, hogy a furinnak nem csak a Golgi-készülékben, a transz-Golgi-hálózatban (TGN, trans-Golgi network) lehet szerepe (intracellulárisan), hanem pl. a sejtfelszínen is. Ott is hasíthat. A háromkomponenses anthraxtoxint pl. ott segíti győzelemhez. Ha jól értem, akkor egyelőre nyitott kérdés, hogy pontosan mi történik a SARS-CoV-2-es esetében.
  • Ez itt az irónia helye lesz. Szóval... annyira, de annyira vártam, hogy a hivatalos kínai járványösszefoglaló majd megvilágít bizonyos részleteket a járvány kezdetével kapcsolatban... de nem :( So sad :(((( 

2020.06.11.

  • Ez a nem túl jól megírt (ezt a nyelvezetére és a strukturáltságára értem) paper azt a lehetőséget veti fel, hogy a vírus S-fehérjéjében az aminosavak töltésének jellege és eloszlása jelentőséggel bírhat a sejtmembránokhoz kötődésben, ion-ion kölcsönhatásokon, azaz ún. sóhídakon keresztül, és hogy ez még a receptorkötő doménen (RBD) belüli receptorkötő motívumon (RBM) belüli furin hasítási hely argininjainak esetében is jelentőséggel bírhat.
  • A magas glükózszint a kockázati faktor diabétesznél, úgyhogy a kezelt diabétesz nem olyan veszélyes, minta frissen felfedezett.
  • US Open, eredmények, lásd alább. Texas és Arizona a tankönyvi V-shaped recoveryt mutatják a vírus szemszögéből. (És mindez még nem mutatja a tüntetéshullám hatását, az csak később jön...)

sarscov2_usreopening.jpg

  • Ez a beszélgetés (május elejéről) eddig elkerülte a figyelmemet. DTK Zacher Gáborral, aki elmeséli, hogy Hatvanban az egyetlen SARS-CoV-2-pozitív beteg, akivel találkozott, húgyúti fertőzéssel került be, légúti panaszok nélkül. Érdekes. Vesekárosodás a SARS-CoV-2 miatt? 
  • Még egy DTK-beszélgetés, és ez a járvány kapcsán erőre kapott telemedicina miatt fokozottan érdekes lehet, Meskó Bertalannal.
  • Egy új paper (U.S. NIH) gépi tanulással és emberi erővel a koronavírusok és a magas esethalálozású koronavírusok (high-CFR coronaviruses: SARS1, SARS2 + MERS) közötti nukleotidszekvencia-beli különbségekről. 11 releváns régiót találtak, a legtöbb a nukleokapszidot és a spike-ot érinti, ezek között némely nukleotidszekvencia-eltérés az aminosav-szekvenciában is kifejeződik beszúródás, törlődés  vagy helyettesítődés formájában. A reggel elsőként idézett tanulmányt is erősíti, hogy a releváns proteinek töltése szignifikáns (erős pozitív töltés), és mintázatuk egy részüknél (háromnál), úgy tűnik, nukleáris lokalizációs szignállá áll össze (NLS, Nuclear Localisation Signal), vagyis szerepet játszhat a vírus bejutásában a célsejtekbe, egy esetben pedig nukleáris exportszignállá (NES, Nuclear Export Signal), vagyis ott éppen a kijutásban játszhat szerepet, érdekes módon. Ráadásul ezek a CFR-el arányosan erősődőnek mutatkozó mintázatok a koronavírusok között.
  • A spike-ban van továbbá egy, a high-CFR koronavírusoknál előforduló beszúródás, mely meghosszabbítja az α-hélix formát öltő összekötő régiót (négy aminosavval) a spike hidrofób fúziós peptidje és az azt körülárnyékoló két ismétlődő, hathélixes szerkezetű amiosav-heptád egyike (HR1) között.
  • Végül a zoonózisok elemzéséhez különböző beszúródásokat találtak külön-külön az egyes high-CFR koronavírusok és legközelebbi ismert állati (lehetséges) elődjeik összevetésénél, ami három különböző evolúciós eseményre utal értelemszerűen. A SARS-CoV-2-es esetében a kritikus beszúródás nagyobb hidrofób interakciós felületet ad az ACE2 receptorral, illetve ion-ion kölcsönhatást és hidrogénkötéseket alapoz meg. Ez magyarázhatja, miért annyival (10-20x) nagyobb a SARS-CoV-2-es spike-jának affinitása az ACE2-es receptorral a SARS-CoV-1-hez képest.

2020.06.12.

  • Egy cikk a vérrögökkel kapcsolatos problémákról orvosi-gyakorlati szempontból. Eredetiben: "Parcha says he recently treated a 30-year-old who attempted to fight the virus at home. Due to clotting issues, he now has permanent heart damage. Parcha says if the patient had come in three days earlier, it could have changed his life." Mint korábban említettem: a "csak a krónikus betegek halnak meg" tábor figyelmébe ajánlható, hogy a SARS-CoV-2 saját maga is csinál krónikus beteget emberekből. Ördögi kör.
  • Még egy kis horror. A huszonéves chicagói beteg két hónapja volt mesterségesen lélegeztetve. A vírus által szétlyuggatott, és a mellkasfalra feltapadt tüdejének a helyére 10 órás műtéttel sikerült egészségeset ültetni. (Tegyük hozzá, hogy ezzel nem biztos, hogy hosszú időre megmentették. A tüdőátültetés egy éves túlélési aránya 80% felett van valamivel. Három év után 55-70%. A fiatalabbak arányai jobbak.) Ha valaki jól viseli az ilyesmit, íme, a transzplantáción átesett hölgy régi tüdeje.
  • Orange County, Kalifornia. Lázadás a masz8kviselési rendelet ellen, fenyegető üzenetek az ezt támogató tisztviselőknek, végül a nyomás hatására a maszkviselési kötelezettség feloldása. Exponenciális járványnövekedés mellett.
  • Egy fülöp-szigeteki nő halála, aki haza akart jutni, de a kijárási korlátozások miatt sem buszjáratot, sem fuvart szerezni nem tudott, és végül magára hagyva, egy gyaloghídon találtak rá. G.a.h.: +83011+n. (Halkan jelzem, hogy a járvány teljes halálozása rég félmillió felett van.)
  • Erősen úgy tűnik, hogy Derek Chauvin minneapolisi rendőrnek személyes indítéka lehetett George Floyd meggyilkolására.
  • Nálunk a wastewater-based epidemiology is kedvező eredményeket hozott eddig: "A tiszti főorvos ... beszélt a szennyvízvizsgálatokról ... Budapesten mindhárom szennyvíztelepről vettek mintát, így a főváros egész lakosságát látják. Ez alapján még mindig ki tudják mutatni a vírust a fővárosban, de jelentősen, egy nagyságrenddel csökkent a vírus kópiaszáma." 
  • Indiában közösségek vesznek oxigénkoncentrátort, pulzoximétereket, hogy valahogyan életeket mentsenek majd.
  • És közben még aminosav-szekvenciákkal is volt időm foglalkozni, és arra az érdekes dologra lettem figyelmes, hogy ez a paper (visszavont anyag, l. a 4. oldalt) és ez a másik (tegnap tárgyaltam itt, l. itt is a 4. oldalt) részben azonos beszúródásokról beszél. A 72-es pozíció az utóbbinál = 80-as pozíció az előbbinél (a második T helye a GTNGTKR beszúródásból). A HKNNKS beszúródásból a K a 150-es pozícióban van az utóbbi paperben, 154-es pozícióban az előbbinél. 680 tájékán jön mindkettőnél a PRRA (kontrollnak említem). Az előbbi paper volt az ominózus indiai paper, amelyik rámutatott, hogy a TNGTKR és a HKNNKS szekvenciák jelen vannak a HIV-1 gp120-as burok-glikoproteinjében is, amelyik ott fontos szerepet játszik a CD4-es T-sejtekbe történő behatolásban.

2020.06.13.

  • A magas fruktóztartalmú kukoricaszirup igen kedvezőtlen hatásairól (Dr. Seheult). Az amerikaiakkal évente átlagosan 24 kiló felett etet az ipar ebből a csodából. Hozzájárul túlsúlyhoz, diabéteszhez, szív- és érrendszeri betegséghez, és még az oxidatív stresszhez is az erekben.
  • Már a korona sem a régi? Egy tanulmány szerint olyan koronavírus-változat terjed újabban, ahol a vírusrészecskéből négyszer-ötször több spike meredezik célsejtek után áhítozva. A háttérben itt a teljes paper. A D614G mutációs stabilizálja is a spike-ot, úgy tűnik. (Emlékeztetőül: az S-protein áll S1 és S2 funkcionális alegységekből. Előbbi receptort köt, utóbbi az ezt követő fúziós folyamatot vezérli.)
  • Trump rájött, hogy esetleg még Mexikóra lehet ráfogni a balhét.
  • Egy érdekes thread arról, hogy a diagnosztizálás mennyivel bonyolultabb, ha különféle bőrszínű embereket kell kezelni. Lásd az alábbi ábrát a COVID kapcsán is előforduló Kawasaki-szindrómáról.

sarscov2_kawasaki_skincolor.jpg

  • Peking eddig viszonylag megúszta, most ott a járvány, pont egy piachoz kapcsolódóan. Persze a kínaiaktól újabban már megszokott kőkemény reakció is megvan. Több tucat fertőzöttet megtaláltak a tünetek jelentkezése előtt.

2020.06.14.

  • Ezt már szeretem. Újságírók, akik képesek kutatóként is gondolkodni, ha kell. Megnézték a harvardi tanulmányt, amelyik a minap a járvány augusztusi kezdetét vizionálta háromból egy saját indikátor alapján, kettő saját ellenében, és a Baidu-kereséseket elvégezték más keresőszavakkal is. Ha nem a "hasmenéses tünetet" nézzük, hanem például simán a "hasmenést" vagy a "légzési nehézséget", akkor december előtt csökkenő trend volt ezeknél. Stanford, Harvard... sok nagynevű egyetem produkált pocsék kutatásokat az elmúlt hónapokban.
  • Amennyiben szociopaták uralkodását az "ügyes" jelzővel illethetjük, Trumpék ügyesen csináltak szövetségi tagállami szintű kérdést a koronavírusból, és szépen kivonultak a téma tárgyalásából.
  • Japán tanulmány. 61 klasztert rekonstruáltak, 22-nél nagyjából biztosan megvan az index-eset, a legtöbb 20-39 év közötti pre- vagy aszimptomatikus hordozó volt. Tanulságos az egyetemek működésének átgondolása szempontjából.
  • A kínai piaci epidemiológiai nyomozás részleteiről bővebben.
  • Nálunk a ma reggeli adatok beérkezése előtt 13,75%-on a CFR (esethalálozási ráta). A reggeli adatok beérkeztével már 13,81%. V. ö.: a belgáknál jelenleg 16,1%. Az olaszoknál 14,49%. A briteknél 14,15%. A svédeknél 9,56%. A spanyoloknál 9,3%. Az amerikaiaknál 5,48%. A braziloknál 5,02%. Ezek nagyjából a legrosszabbul állók, és egyébként nem a vírus halálosságában van igazán nagy különbség, azt hiszem, ez megkockáztatható hipotézisként. Mint említettem, azt életszerű feltételezni, hogy ha a CFR eleve magas, és a tetejében emelkedik, akkor a járvány felderítetlensége nő. Mivel pedig egyébként szám szerint, arányosan nézve sokat tesztelünk, ebből elvileg az is következhet, hogy azok a tesztek... nem sokat érnek. Például sok lehet a fals negatív. Ez csak egy lehetőség, de olyan számok mellett, amikkel itt találkozunk (teszteltek száma, megerősített pozitívok száma, elhunytak száma), az ellentmondásokat például ez oldhatja fel.
  • Müller Viktor (ELTE, biológus) arról, hogy neki is meglepetés volt a lazítások után a gyors terjedés elmaradása nálunk, de hogy ebben biztosan szerepet játszik, hogy az emberek most már nem töltenek huzamosabb időt együtt nagy számban zárt terekben. Hogy szeptembertől mi lesz, az persze más kérdés, úgy értékeli. 
  • Cancer Alley, az út menti sáv Baton Routge és New Orleans között, sok olaj- és vegyipari létesítménnyel, a rák mellett a légúti betegségek magasabb előfordulásával. COVID-19-ben is élpozícióban, sok fekete-amerikai lakossal. Ebből kivetítve: az anyagilag megengedhető, és ezzel összefüggésben sokszor egészségtelenebb lakhatási körülmények is hozzájárulnak a magasabb fekete-amerikai halálozáshoz a járvány során. A legcsúnyább csavar a történetben, hogy a fekete-amerikaiak lakta terület nem feltétlenül volt valaha egészségtelenebb más térségeknél, viszont naná, hogy véletlenül oda települt az ipar.
  • Indiában a járvány átüti a kórházikapacitás-plafont, jönnek az átalakított vasúti kocsik. A hivatalos indiai halálozási adatok sajnos egészen biztosan aluljelentettek.
  • Ebből a cikkből kiderül a tavaszi iráni metilalkohol-mérgezések áldozatainak teljes száma. Mint ismeretes, elterjedt az a helytelen nézet, hogy a szesz megvéd, és ebből lett ez a probléma. 796-an haltak meg (ebből korábban 390-et számoltam a magam részéről). Ugyaninnen: egy házaspár az Egyesült Államokban, akik klorokin-foszfátot ittak megelőző gyógymódként (még márciusban) és ez után a férj meghalt. G.a.h.: +83418+n. A SARS-CoV-2 nevű baleset áldozatainak száma így 517020 este 7 órai állás szerint (konzervatív számítással).
  • Zárásnak még egy kis irodalom a (balesetes) laboratóriumi eredetű fertőzésekről (LAIs, Laboratory-Acquired Infections).

Folyt. köv. Június 15-től új bejegyzésben majd (14-én még itt).

16 komment

A koronavírus-járvány a lazítások után

2020.05.15. 22:10 :: Marton Péter

 Előzmények (korábbi kutatási jegyzeteim a témában):

2020.05.16.

  • Boncolás nyomán a citokinvihar hatásairól COVID-19-ben elhunyt betegeknél. Az előző bejegyzés legvégén, a kommentek között retorikailag rákérdeztem, hogy Klaus Püschel német patológus, aki mostanában sok kört ment a médiában egyes helyeken, és azzal szórakoztatja a nagyérdeműt, hogy nem látott még embert, aki a koronavírustól halt volna meg, mert mind beteg volt már előtte is, vajon mit szólna egy ilyen tanulmányhoz. És akkor elém került ez a Spiegel-cikk, ahol ő is szóba kerül, hasonló felfogásban gondolkodó patológusokkal együtt. "They all had in common that they suffered from severe malfunction of their blood vessels," nyilatkozza a cikkben pl. Alexander Tzankov bázeli orvos. "The cause of death tended to be a respiratory tract infection, a lung infection, a pulmonary embolism or a combination of all three. The most common pre-existing conditions found by the pathologists pertained to the cardiovascular system or the lungs", számol be a Spiegel ezek után Püschel leleteiről is. És így már értem. Úgy tűnik, hogy ezeknek a patológusoknak nehezükre esett megérteni, hogy a SARS-CoV-2 mit tesz az érfalakkal és a szívvel. A vaszkulitiszt/endothelialitiszt, az oxidatív stresszt, és egyebeket. Mindössze annyit tévednek, hogy (legalább részben) összekeverik az okozatot az okkal.
  • Kieg. az iméntihez: itt egy tanulmány, mely férfiak esetében 13, nők esetében 11 életévnyi veszteséggel számol átlagosan a páciensek populációjából vett minta vizsgálata alapján.
  • Lehet, hogy izgalmas dolgok is előkerülnek majd ebből a kiszivárgott kínai járvány-adatbázisból, az eü. rendszer katonai ágából. Amit most lehet látni (effektíve még nem publikáltak semmit): (1) itt sem fog kiderülni, hogy hány katona fertőződött meg a Népi Felszabadító Hadseregből, vagy éppen a börtönökben (h/t rdos); (2) februártól indulnak az esetek, szóval nincsenek ebben az adatbázisban az ismert időrendet megelőző esetek.
  • Apropó, ismert időrend. A Lancetben még korábban megjelent tanulmányból a kritikus idővonal e tárgyban íme, alább, a saját kiemeléseimmel:

sarscov2_timeline_lancet.jpg

  • Mint látható, az ábra kicsit torzít, mert a december 1. és 10. közötti időszak napjai nincsenek megjelenítve, utána pedig időarányos szakaszok következnek az időtengelyen. A december 1-én megjelent eset egyike azoknak, amelyeknek nem volt köze a Huanan piachoz — háromból egy december 10-inek már volt folyamatos kapcsolata a piaccal. Bár elvileg "illness onset" dátuma a december 10., a tanulmányból dekódolható, hogy a december 15-i esetek egyike ennek a férfinak a felesége volt. Viszont akkor a december 10. valójában a hospitalizáció napja, amit megelőzően a férfi 7 napig köhögött és lázas volt, illetve légszomja alakult ki. Az inkubációs időt is figyelembe véve így ez az eset december 1. előtt fertőződhetett.
  • Fontos adalék az ügyben, hogy az SCMP talált valamilyen "kínai kormányzati" adatokat, melyek szerint egy 55 éves személy lehetett koronavírusos beteg már november 17-én. Laboratóriumi megerősítés a fentebb idézett Lancet-tanulmány szerint csak december 16. utáni esetekre van sajnos, így nehéz megítélni, nem egy influenzás beteget nézegetünk-e éppen a nyomozás izgalmában. Arról sincs szó, hogy a november 17-i (akkor kórházba került?) betegnek volt-e köze a Huanan piachoz; a kérdés fel sem vetődik a cikkben.
  • Ahogy már tegnap felvetettem, Tanzánia sajnos tényleg a COVID World Tour nevű globális shitshow következő állomása. Idézem: "Abdul*, a close relative of Kwikima, said when they visited the department of health at the Ilala municipal council on April 30 to discuss the burial, they saw the worker on duty open a book titled Mazishi ya COVID-19- Swahili for "COVID-19 burials" - and that Kwikima was the 256th name in the book." Azok után, ami a cikkben szerepel, nincs kétségem az információ hitelessége felől, pláne a hivatalos adatok nem túl életszerű eloszlását látva, és tudva, hogy a tanzániai laborok teljesítményét maga a tanzániai elnök, John Magufuli is megkérdőjelezte. Mivel április 30-ig csak 16 halálesetet jegyeztek hivatalosan, globálisan a g.a.h.: +65285+n.
  • Vissza a sejteken belülre. Egy nagyon érdekes tanulmány a mikroRNS-ek (miRNA) szerepéről, in silico. SARS-CoV-2-re specifikus 315 mikroRNS hatása, és ezek sajnos az életkorral csökkenő mennyiségben vannak jelen a szervezetben. 
  • Április 28-i naplóbejegyzés egy vidéki kórház osztályvezetőjétől, a Válasz Online közlésében: "Kétoldali tüdőgyulladás, láz, komoly oxigénhiányos állapot. COVID-gyanú nincs, mert a beteg nem teljesítette az esetdefiníciót, nem járt külföldön." Ez csak egy vicc, ugye? Értem én a tréfát.
  • A Theodore Roosevelt repülőgép-hordozó legénységéből néhány tengerész tesztje úja pozitív lett — a tesztre influenzaszerű tünetek kapcsán került sor. Nyilván figyelni kell majd erre a szálra is.

2020.05.17.

  • Gyógyszer-ellátás, amerikai függőségek Indiától, többek között a hidroxiklorokinnal kapcsolatban, az Indira Gandhi-féle 1970-es szabadalmi törvényig visszavezetve.
  • Egy fontos exkluzív interjú a CNN-en, dr. Zhong Nanshannal, a kínai kormányzat eü. főtanácsadójával, aki az első SARS-járvány idején tűnt ki annak idején. Highlights: (1) a kínai lakosság nagy része továbbra is fertőzetlen, azaz fertőzhető, és jöhet második hullám (európai és észak-amerikai illuzionisták figyelmébe ajánlott tanács is lehet); (2) Január 28-ig volt szerinte probléma az adatokkal, addig gáz volt a helyzet ezen a téren szerinte is. Idézem: ""I didn't believe the results, so I (kept) asking ... you have to give me the real number," he said. "I suppose they were very reluctant to answer my question.""
  • G.a.h.: +65287+n. Az ilyen eseteket, mint ez, vagy ez, nehéz máshogyan számolni.

2020.05.18.

  • Az év legnaivabb mondata a Portfolio.hu-n., az új, laboratóriumilag megerősített fertőzések száma kapcsán (+26). "Utoljára egy hete jelentettek ilyen alacsony adatot." Igen, utoljára egy hete volt vasárnapról hétfőre virradó éjjel. Egyébként pedig Dél-Koreában ennyi új eset kapcsán verik a vészharangot. Az esethalálozás nálunk 13% felett — ha a hivatalos adatokból indulunk ki. Utóbbi annyiban mindenképpen jelentős, hogy ha valakinél tesztelés történik, és kimutatják a fertőzést, annak ténylegesen ilyenek az esélyei, amennyiben az életkortól és krónikus betegségektől elvonatkoztatunk.
  • A SARS-CoV-2 közben így terjed valójában: exponenciálisan. Egy dermatológiai konferencia résztvevőinek a története. Szemtől szemben üldögélés, kézfogás, taxizás. A transzmisszió idején az index-eset pre-szimptomatikus volt, később belázasodott. Az eredmény 85%-os átfertőzöttség. Csak ketten maradtak aszimptomatikusak (17%) a fertőzöttek közül. 
  • Fitness táncórák Dél-Koreában. Az intenzív beltéri testmozgás mellett kiabáló instruktoroktól óvakodj, az ő tüdejük tartalma a te tüdőd tartalma is végül.
  • Különféle infarktusok is előfordulnak a koronavírusos vérrögképződés eredményeként, ezt már tudjuk. Itt van három eset leírása hasüregi infarktussal.
  • Még nem néztem végig teljesen, de itt egy jó videó a renin-angiotenzin rendszerről., bár még az ACEI/ARB-kezeléssel kapcsolatos klinikai adatok nagy része előttről. Tekintve, hogy az angiotenzionogént a máj, az azt hasító renint pedig a vese termeli, a vírus támadása ezekben a szövetekben is hatással van a rendszerre, megkockáztatom — túl az ACE2-es receptorok lekötésén.
  • 12 boncolás tanulságai Németországból (Püschel is a szerzők között, úgyhogy ezek szerint most már látott koronavírustól meghalt beteget). Vérrögök, diffúz alveoláris károsodás (DAD), limfociták behatolása, elnehezedett, folyadékkal telt tüdők, a vírus-RNS jelenléte nagy mennyiségben különféle szervekben 5/12 páciensnél. Terápiás szempontból a heparinkezelés vérkép megfigyelése nyomán nyilván alap, innentől.
  • Az orosz illetékesek — nem meglepő módon — játszanak az adatokkal, és a boncolás függvényében különbséget tesznek a "died of" és a "died with" esetek között, hogy aztán csak az előbbieket kelljen számítaniuk, és így produkáljanak jobb esethalálozási arányt. Ennek a mértéke: áprilisban a valószínűsíthető eseteken elvégzett boncolások nyomán Moszkvában csak 639 esetben erősítették meg a koronavírust a halál okaként, és ez ment a WHO-nak is küldött statisztikák közé. Az esetek 60%-át leírták másnak. Vagyis mintegy 958 esetet hagytak figyelmen kívül. G.a.h.: +66245+n. Kieg.: a Financial Times a szezonális átlagot meghaladó moszkvai halálozásról.
  • Az Egyesült Államokban a szezonális átlagot meghaladó halálozásról. Minden COVID-19-es halálesetet extrának tekintve, azt kivonva a teljes extra adatból (konzervatívan) a következők jönnek ki az általam eddig nem számított államok esetében. Kalifornia: +400 (III.15-Iv.25.); Virginia: +200 (III.15-IV.18.); Dél Karolina és Arizona: +100+100 (III.15.-IV.18.); Mississippi: +50 (III.15.-IV.11.); Vermont: +50 (III.15.-IV.18.); Utah: +30 (III.15.-IV.25.); Washington, D.C.: +10 (III.15.-IV.11.); New Hampshire: +10 (III.15.-IV.25.); Wyoming: +60 (III.15.-IV.11.). G.a.h.: +66245+1010+n=+67255+n.
  • John Olivertől két kiváló fellépés. A "buborékligázásról" gondolkodó sportszövetségekről. És az amerikai postaszolgálat (USPS) messze a koronavírusnál korábbról, és konkrétan törvényhozóktól eredő válságáról (lásd: Postal Accountability and Enhancement Act). Az előre fizetendő egészségbiztosítási járulékok miatti kötelező tartalékolás, és különféle szolgáltatások árplafonjának szabályozása után jön a mániákusan közszolgáltatásokat gyilkoló politikusok támadása, akik előbb-utóbb nyereséges működést és önfenntartást várnának talán még az általános iskoláktól is.
  • A fertőzöttek tartós egészségkárosodásairól. A nyájimmunitás illúziójáért folytatott küzdelem a "nyáj" egy részének lepusztításával járhat. A folytatás a shitshow szellemében: mivel ők már krónikus betegek lesznek, egyesek szerint gyakorlatilag félig halottnak tekinthetők, és egy "ügyes" kórboncnok még azt is megállapíthatja majd évek múltán, ha úgy alakul, hogy nem is a COVID-19 volt az igazi bajuk.
  • Visszaeső újra-pozitív eset, Ausztrália.
  • 10-6-8-6-11-30: a halottak hivatalos számának duplázódásához szükséges napok száma az elmúlt hat duplázódási ciklusra visszatekintve. Így vagyunk a nap végére 320 ezernél.

2020.05.19.

  • A szennyvízcsövek kis hibái virális aeroszolokkal lephetnek be helyiségeket. A fürdőszobában és másutt időről időre érzett rossz szagok ennek a lehetőségét jelezhetik. Modellezték, fizikailag.
  • A minden vizsgálat nélkül is a WHO-t bűnbaknak megtevő Egyesült Államok miatt a WHO támogatná, hogy független vizsgálat induljon a járvány kialakulásáról, de ezt Kína csak akkor fogadja el, ha egészen-egészen független az a vizsgálat. WHO politics.
  • Gyógyszerpolitizálás. Japán és a favipiravir. Idős betegeknél jó lehet, de terhes asszonyoknál születési rendellenességekhez vezethet.
  • Mivel mára csak 21 új esetet találtak, és számomra nem világos, mi működik nálunk máshogyan, mint odakinn, a nagyvilágban, körkép. Az átfertőzöttség Magyarországon nagyon alacsony, ez nem akadálya a járványnak. Van már autós vírustesztelési lehetőség, de napi 100 a kapacitás, az ár pedig 26900 Ft. Friss klaszterek Ausztriában, Hagenbrunnban a postaszolgálat a katonaság részvételével tud tovább működni.  De tegnapra csak 27 új esetet találtak. Szerbiában tegnap 89, Romániában 156, Ukrajnában 325 új eset. A szlovéneknél nem volt, Szlovákiában egy, a horvátoknál csak kettő. Nem mindegy, ki mennyit tesztel, persze.  Már csak az a kérdés, hogy a szlovén-szlovák tengely, vagy a szerb-ukrán-román klaszter részei vagyunk-e.
  • Apropó, átfertőzöttség. A Merkely-féle H-UNCOVER-vizsgálat saját számításaik szerint 2,7 ezrelékes eredmény felé tendál, ami igen hasonló esetszámmá konvertálható, mint amit a napokban projektáltam a dél-koreai CFR-ből kiindulva. Szóval akkor reálisan 20 ezer feletti lehet az esetszám Magyarországon. Kieg.: azt viszont nem tudom, hogy jön ki a 2,7 ezrelék, ha "1524 vérmintából 9 volt pozitív" (antitestekre). Ez fura. Úgy a tényleges esetszám magasabb is lehet.
  • Az Index cikke arról, milyen magatartás a célszerű a relatív lazaság állapotában. Általában nem rossz, de pl. leírják, hogy "a közös ételhez csak tiszta evőeszközzel nyúljunk", ami félreértésekre adhat okot. A szánkba tett, azaz ott összenyálazott evőeszközzel már ne nyúljunk újra oda. Az már nem tiszta.
  • Adatok arról, hogy a beltéri transzmisszió dominál ebben a járványban.
  • Az Index azt írja, hogy Trump hülye, és ez nyilván igaz, de a cink+hidroxiklorokin kitettség utáni profilaxis kombóval nem feltétlenül jár rosszul, az a helyzi. Aki tanácsokat ad neki az ügyben, nem hülye. Trump szívét (vagy a kavargó sötét anyagot, ami a helyén van) nyilván megfelelően monitorozzák is közben. Sean P. Conley az orvos neve. PEP-ként vetődött fel a kombó fogyasztása, azaz mint Post-Exposure Prophylaxis, miután a Fehér Házban is lett pár eset. Talán éppen ez alapján a dél-koreai tanulmány alapján döntöttek róla, többek között. Így megy ez — a fontos emberek esélyei "természetesen" jobbak az átlagos emberekénél.
  • A svéd "csoda". Itt egy részletesebb tanulmány is: férfiaknál 3, nőknél 2 év veszteséget mutat ki várható élettartam tekintetében a tizenharmadiktól a tanulmány zárásakor figyelembe vett tizenhatodik hétig tartó időszak eredményeként (amit a naptári évre kompenzálhat még az, ha később kevesebben halnak meg, de ezt a kutatók nem tartják túl valószínűnek). 
  • A COVID-19 World Tour nevű globális shitshow szerves része, amikor az ember szembesül azzal, hogy kritikán aluli morális integritással kormányozni a világon mindenütt lehetséges. Floridában is. Innentől számomra az amerikai adatok megbízhatóságánál is van egy kis bizonytalansági faktor. Meg egy kis diszkomfort.
  • Ioannidisék a Stanfordon ilyen finanszírozási háttérrel produkálták a "következtetéseiket" (=következődéseiket) arról, hogy mennyire nagy az átfertőzöttség már Kaliforniában. Jut eszembe, Michael "két hónap alatt kiég a járvány" Levitt is a Stanfordon kutató. Ez most csak úgy az eszembe jutott, mivel a hír a Stanforddal kapcsolatos. Szabad asszociáció.
  • Egy floridai férfi és a felesége esete. "Fake crisis"-hívő volt a férfi.
  • Egy 2005-ös tanulmány New Havenből az akkor újnak számított NL63-as koronavírus egy ottani variánsa és a Kawasaki autoimmun betegségre emlékeztető kondíció előfordulása közötti összefüggésről. Megjegyzi, hogy korábban is voltak adatok a Kawasaki hullámszerű jelentkezéséről téli hónapokban, jellemzően 3 hónapnál idősebb gyermekeknél.
  • OMG. Március elején írtam ezen a blogon a december eleji wuhani esetek kezeléséről: "Érdekes volt látni, milyen jól felkészültek voltak a kínai orvosok az ARDS kezelésére már a kezdet kezdetén (hasra fektetés, leszedálva lélegeztetés, kis légzési térfogatú lélegeztetés stb.)" Ezek után tényleg a levegőt kapkodom döbbenetemben, mert elképzelhető, hogy az amerikai halálozási statisztikákat rossz orvosi gyakorlat rontja. Nem gondoltam volna, de úgy tűnik, hogy sok kórházban máig pumpálják a betegekbe a levegőt, ahogyan a csövön kifér

2020.05.20.

  • Kiváló elemzés a húsipar helyzetéről a G7-en. A húsüzemek járványproblémája felbukkant már az Egyesült Államokban és Németországban is, többek között. Okok: "A feladat nagyon munkaintenzív, ezért a munkafolyamat egyes pontjain szorosan egymás mellé állítják a fizikai erőt kifejtő, szaporán lélegző dolgozókat" + méretgazdaságosság miatt a nagy üzemek a nyerők, és a nagy verseny miatt feszített munkatempó van.
  • Dagesztán. A helyi eü. miniszter, Dzhamaludin Gadzhiibragimov a központi adatokkal szemben (3553 eset, 32 halott) közölte egy Instagram-interjúban (!), hogy a valódi helyzet 13 ezer feletti esetszám és 657 halott. Igaz, nem tudnak különbséget tenni tüdőgyulladás és tüdőgyulladás között, de egyrészt nincs már influenzaszezon, másrészt a COVID-19 nem feltétlenül tüdőgyulladásként öl, úgyhogy az adat abszolút mérvadó. Abba nem jó belegondolni, hogy Gadzsiibragimov szerint "Basically, the same [treatment] methodology is used for both", azaz hogy szerinte minden tüdőgyulladást ugyanúgy kell kezelni alapvetően. G.a.h.: +67255+625+n=+67880+n.
  • Íme, a "k" terjedési mutató: a terjedés diszperziós faktora (avagy klaszteresedési mutatója). Értéke 0 és 1 között, a 0-közeli jelent terjedést kevesektől sokak felé, az 1-hez közeli jelent 1o1 (one-on-one) terjedést. Tekintve, hogy a SARS-CoV-2-nél a k valószínűleg alacsony, a klaszterek megelőzése nagy szerepet játszhat.
  • Hollandiában a nyércfarmokon terjed egy ideje a fertőzés, most egy nyércnek sikerült megfertőznie egy ott dolgozó embert; új zoonózis. Szerintem semmi extra nincs benne — az igazi "extra" az, hogy Kínában egyetlen zoonózis-incidens vezetett a járványhoz (ha az állatok között járvány van, több ilyen is lehetett volna). Egyéb érdekes részletek: 2024-ig engedélyezett a nyérctenyésztés a hollandoknál, addig a nyércbunda a kínai, a koreai, a török és a görög piacra megy. Stratégiai olvasat: a nyércekkel is kell kezdeni valamit, ha ezt a járványt fel akarja számolni AZ EMBER.
  • Ilyen orvosok vesznek oda ebben a járványban, miközben idióták előadást tartanak arról, hogy az áldozatok igazából nem számítanak.
  • És akkor egy kis IR (International Relations). Mivel a válság Kínának és az Egyesült Államoknak is rossz, az anarchia fog fokozódni a nk-i rendszerben. A szerző Kevin Rudd, volt ausztrál miniszterelnök és külügymin.
  • Wastewater-Based Epidemiology hazánkban is. (H/t Epikurosz.) Ajkán, Budapesten, Debrecenben, Győrben, Miskolcon, Nagykanizsán, Pécsen, Szegeden és Veszprémben — ami a megyei adatok ismeretében nekem jónak tűnik.
  • Egy igazán jó összegzés a magyar járványhelyzetről és az eddigi intézkedésekről. Alá tudnám írni — bár azt meg kell, hogy mondjam, hogy ősznél korábban is el tudok képzelni jelentős terjedést.
  • Egy érdekes érv a nyájimmunitás-szerűségre aspirálóknak: "We likely need >75-80% immunity or more, which means a cost of harming 3-4 to protect 1". Ki lehet számolni ezt, valóban, és a tetejében ez még optimista, mert ugye az az 1 sincs megvédve, ha pl. egy év elteltével bye-bye, immunitás.
  • A WION tudósításait érdemes figyelni. A nem szoros ellenőrzés alatt álló laboratóriumokat Kína a vírusminták megsemmisítésére utasította "másodlagos katasztrófák megelőzése érdekében" még a járvány elején (kora januárban) (idézett forrás: Liu Dengfeng, a kínai Országos Eü. Bizottság funkcionáriusa; korroborációhoz). Miután a "harcos farkas" diplomaták ellentámadásai nem váltak be, Kína finomabb hangra váltott, és pl. Jackie Chant vetette be az imidzse javításáért Indiában. Kínai-ausztráliai kereskedelmi háború, miután Ausztrália támogatná Tajvan megfigyelői státusát legalább a World Health Assemblyben. Konteó-offenzíva az izraeli kínai nagykövet halála körül.
  • Új-Zélandon a vírus lehetséges laboratóriumi eredetéről cikkeznek közben, kutatás alapján, mivel az elemzés szerint "data does not point to cross-species transmission of the virus at the market".
  • Itt a tanulmány, amelyikre hivatkoznak. A tobzoskaelméletet gyengének találja. A SARS-CoV-2 emberi adaptálódásának mértékét pedig figyelemre méltónak, tekintve, hogy kevesebb genetikai polimorfizmust produkál, mint a szelekciós nyomásnak (adaptáció tekintetében) anno jobban kitett SARS(-1) annak idején, ami arra utal, hogy már a kezdet kezdetén megfelelően adaptálódott lehetett. Íme, ábrán, a tanulmányból.

sars_cov2_sarsvssarscov2_genetic_polymorphism.jpg

  • Az oxfordi csimpánz-adenovírusos vakcina közben nem akar működni; a kísérleti majmaik megfertőződtek, vírust ürítettek. A Moderna nevű cég egyelőre jól halad egy mRNA-vakcinával, akárcsak a kínai Sinovac a maga inaktivált vírusrészecskés vakcinájával — utóbbi már komolyabb próbát is kiállt. A Moderna sajnos még lufi is lehet, már, erősen elkapkodott módon scale-up manufacturing kapacitásba fektetnek, a tőzsde pedig rövid ideig szárnyalt a hír hallatán — nekem erősen az az érzésem, hogy a befektetők motiválása irányítja a kommunikációt.
  • Kínának sok kintlévősége van a járvány és a gazdasági válság sújtotta országokban, és már érkeznek is a jelzések, hogy adósság-átstrukturálásra vagy -elengedésre lenne szükség.
  • Észak-Kína: eltérő klinikai kép, módosult betegséglefolyás? Hosszabb inkubáció? Nem örülünk.
  • A nap végére: ez saját elemzés az MTA-TK-JTI blogján, Hoffmann Tamás nemzetközi jogász kollégával társszerzőként. Global Public Health meets International Law. Az R2P elv és a pandémia összefüggéseiről.

2020.05.21.

  • Itt a következő zseni. Isaac Ben-Israel, matematikus. Megnézte, hogy a világ országaiban többnyire 40 nap alatt eljön a halálesetek számának csúcspontja, és ebből levonta, hogy ez akkor így "természetes". Szerintem ez az ember sokkal okosabb annál, hogy ekkora baromságokat mondjon — úgyhogy furcsának találom a dolgot. Mikor kérdőre vonták, hogy ugyan mitől lenne ez így természetszerűleg, beavatkozás, gazdaság leállítása stb. nélkül is, szinte cinikusan ható válaszokat adott. "The numbers speak for themselves", mondta a számok nevében. Aztán kicsit őszintébben: "I have no explanation. There are all kinds of speculations. Maybe it’s related to climate, or the virus has a life-span of its own." A mondat utóbbi részével egyben azt is jelezte, hogy a vírusokról segédfogalma sincs.
  • Indiai cikk adatokkal arról, hogy a mumbai rendőrök között a hidroxiklorokin-szulfátos (pre-exposure!) profilaxis kúra  (PREP) jó hatással lehet, nem-szignifikáns mértékű különbséggel a kúrát követők javára.
  • A furin hasítási helyről. Német kutatók úgy találják, hogy alapvető stratégiai jelentősége van a sejtek fertőzésében. Ebből a tanulmányból mellékelem a listát humán, denevér- és tobzoska-koronavírusokról. A hosszú listában sehol máshol nincs ott ez a furin hasítási hely. A PRRA szekvenciát kell nézni, ott van, ni.

sarscov2_betacoronaviruses_unique_furin_cleavage_site.jpg

  • Apropó, módszertan. A német kutatók generáltak mutáns S-fehérjéket, hogy a SARS-CoV-2 saját S-fehérjéjének (és azon belül a furin hasítási helynek) a funkcióját jobban értsék, de ők nem kombinálták az S-fehérjét HIV-1-el, mint ahogy azt Shi Zhengliék tették. Hanem, ahogy azt írtam anno kritikaként Shi Zhengliékről itt én is, Shi Zhengliékkel ellentétben a labormunka-biztos VSV-vírust használták vektornak. 
  • A német kutatók egyébként konzervatív következtetésre jutnak: "It will thus be interesting to determine how the multibasic motif was acquired by SARS-CoV-2, and a recent study suggested that a recombination event might have been responsible". Azért ez így a levegőben lóg nagyon.
  • A dél-koreai CDC tanulmánya arról, hogy az újra-pozitív esetek nem fertőzőek. Szoros kontaktjaikat ellenőrizték (700+ főt), és nem volt köztük pozitív lelet. Az érdekes ugyanakkor, hogy az újra-pozitívak közül az új pozitív teszt idején sokan (44,7%) mutattak tüneteket (köhögés, torokgyulladás), és ezt csak egy részüknél lehetett más fertőzéssel magyarázni.
  • Amerikai tanulmány (Uni of Washington). 1,3%-os CFR-t hoz ki az Egyesült Államokban. Prognózis: "the conservative estimate of 20 percent of the US population becoming infected by the end of this year could result in the number of deaths climbing to between 350,000 and 1.2 million. However, (the authors) were quick to add that these projections are subject to change depending on the public health response".

2020.05.22.

  • Írtam itt korábban a veleszületett immunrendszer részeként fontos szerepet játszó intracelluláris tollszerű receptorokról, és hogy már a SARS is kicselezte ezeket sokszor. Úgy tűnik, a SARS-CoV-2 rendkívül jó eredményességgel kerüli el az I. típusú interferon (IFN-I) válaszadást, ami viszont több mechanizmuson keresztül idővel túl nagy citokinválaszt indít be. Az IFN-I-blokkolás is egy komoly fegyvertény a vírus részéről, bár a végén a gazdát elpusztíthatja a citokinvihar (ahogy a cikk írja: "ez egy fegyverkezési verseny, de határfeltételekkel"). Itt a cikkben hivatkozott áttekintő tanulmány az IFN-I-válasz elkerülését szolgáló vírusstratégiákról (általában mindenféle vírus esetében). A tollszerű és a citoszol-beli RIG-I receptoroktől elhatárolódás valamilyen membrán vagy burok mögött, vagy éppen az aktiválódott receptorok által elindított, az IFN-I-válaszhoz vezető kaszkád blokkolása valamilyen ponton szerepet játszó molekulák vírusfehérjék általi lekötésével stb. Ez még csak a kezdet...
  • Közben arra jutottam, hogy elég fontos lenne tudnunk a magyar járványügytől a jelenleg ismert fertőzötteknél tapasztalt valószínűsíthető inkubációs időt. Ha igaz, hogy Kínában most hosszabb inkubációs időket látnak, akkor nálunk a tegnap előtti +42, a tegnapi +43 és a mai +37 eset még a kijárási korlátozások idejéből származhat akár, vagyis akkor a fogékony-fertőzött érintkezések számának valószínűsíthető növekedése (SI) még csak ez után fejti majd ki a hatását. A hosszabb inkubációs idő lehet akár a globálisan életbe léptetett kontaktredukciós intézkedések miatti szelekciós nyomás eredménye is, úgyhogy már csak ezért is érdekes lenne ezt jobban megnézni.
  • Egy kósza gondolat közben. A vadászmenyétek a Mustelidae családba tartoznak. A SARS-CoV-2 pedig úgy terjed a szintén ebbe a családba tartozó nyércek között, mintha csak hazatért volna közéjük. És hol van sok vadászmenyét...? Nos, hát, pl. virológiai laboratóriumokban, kísérleti állatként. Azt már megállapította konkrét kutatás is, hogy a vadászmenyétek erősen fogékonyak a SARS-CoV-2-fertőzésre. Lásd itt is. Az utóbbi kettőből az előbbi, vagyis ez a tanulmány konkrétan kínai kísérletezés eredményeit közli például.
  • Arról, hogy a szerzett immunitással kapcsolatos kilátások nem túl jók, és hogy a vakcinafejlesztés sem feltétlenül befutó. 
  • Pont azon gondolkodtam, hogy Csecsenföldre kicsit jobban rá kellene nézni, mert ha Dagesztánban gáz van, akkor náluk is rossz lehet a helyzet. Hát, Ramzan Kagyirov kórházba került Moszkvában.
  • Igazából nem lep ez meg, de a svédek úgy tartották nyitva az iskolákat, hogy egyáltalán nem próbálták a gyerekek között követni a járvány terjedését, vagy adatokat gyűjteni erről. Ha valakinek még kétségei lettek volna arról, hogy amit csináltak, az felelőtlen volt.

2020.05.23.

  • A mai napot is egy kósza gondolattal kezdeném. Tekintve, hogy mennyire rövid távúak a kilátások a szerzett immunitással, nem árt már most leszögezni, hogy a járványnak varázsütésre nem lehet véget vetni egy vakcina révén, még ha elérhetővé is válik. A járvány felszámolásához az kell majd, hogy az addigra lassuló terjedés mellett kőkeményen menjen a kapcsolatkövetés, és az útjába lehessen állni a további fertőzéseknek gyűrű-vakcinációval, vagyis körbeoltva a fertőzöttek kontaktjait (ahogy anno a fekete himlőnél is történt). A végén a kapcsolatkövető munkát tehát nem lehet megspórolni, vagy ha mégis azt teszik, akkor marad a járvány.
  • A kapcsolatkövetéssel jelenleg számos ország gondban van, például Kanada is. Ontarióban pl. jelen állás szerint az esetek kétharmadában nem tudják vagy nem próbálják felderíteni a fertőzés forrását.
  • Eközben a dél-koreaiak 46 ezer embernek mentek utána, hogy az Itaewon-klasztert felszámolják. Immár a második hullámot zárták rövidre anélkül, hogy általánosan leállították volna az életet.
  • Az eü. ellátásban keletkező alapvető zavar közben életeket követel még relatíve alacsony esetszám mellett is, ezért is óriási hiba nem foglalkozni a járvány elvágásával. Újabb ilyen eset nálunk, egy fiatal nő agyhártya-gyulladással. G.a.h.: +67881+n.
  • Hongkong megmaradt autonómiája komoly támadás alatt.
  • Oroszországban is hamar nekiláttak embereken kísérletezni a fejlesztett vakcinával (egy adenovírus-vektoros verziójuk van).

2020.05.24.

  • Az új esetek számának alakulását figyelni nálunk eléggé uninformatív, ha lehet ilyet mondani. Hetek óta hétvégén nyugszik, hét közben kel a járvány, fittyet hányva a tipikus járványmatematikára. Úgyhogy elkezdtem nézni a karanténozottak számát, és abban van egy kis mozgás: május 22-én 11668, május 23-án 11704, május 24-én 11934 fő hatóságilag elkülönítve. Ez érdekes, mert ez +266 fő, miközben az aktív esetek száma elvileg csökkent ezekben a napokban.
  • Jemenben is gondok lesznek. Az MSF 68 halottról tud saját eseteiből április 30. és május 17. között. A hivatalos adatok szerint május 17-én csak 20 halott volt. Ez minimum +48 haláleset. G.a.h.: +67929+n.
  • A cikk szalagcíme sokat sejtet, aztán annyival nem leszünk okosabbak mégsem. 125/980-as esethalálozás mellett a részleges izolációban élő dél-amerikai őshonos lakosságokra azért mindenképpen érdemes figyelni, mert immunológiailag extra naiv populációk lehetnek.
  • Missouri, US. Két fodrász (egy fodrászatnál) 140 klienst tett ki fertőzésveszélynek, miután már szimptomatikus állapotban dolgoztak. Minden vendég adatai fel voltak írva, így a helyi járványügyisek meg tudták keresni őket. "I'm going to be honest with you: We can't have many more of these. We can't make this a regular habit or our capabilities as a community will be strained", mondja erre a megyei eü. hivatal, jelezve, hogy ennyire sok embert már nem lehet tartósan követni... Jó ég, mi lett volna, ha a vendégek adatai nincsenek felírva?

2020.05.25.

  • Már csökkent itthon a karanténezettek száma (11810-re). Ez figyelemre méltó. A "csak +15 eset" kevésbé, mert vasárnap mindig visszaesés van a tesztelésben.
  • Kis történelem: a 2004-es SARS-minijárvány hátteréről. Mint ismeretes, ott elismerten laborbaleset történt.
  • A Virology blogon közben újra ránéztek a furin hasítási hely kérdésére — csak a gondolatmenet jellemzése végett idézem. Parafrázisban: "Hm, hát akkor a polibázisos furin hasítási hely tényleg jelentős, úgy tűnik. Honnét kerülhetett oda? Hát, nem tudjuk, de biztos odakombinálódott valahogyan. És mivel kínai kutatók közben kikutattak egy 61%-ig hasonló (azaz nem igazán közeli rokon, mintegy 10000+ bázispárral különböző) másik denevér-koronavírust (RmYN02), az első olyat, amelyiknek szintén van egy S-fehérjés beszúródott aminosav-szekvenciája éppen az S1-S2 funkcionális elemek (az S1 a receptorkötésért, az S2 a fúzióért felel), ezért az ilyesmi akkor "biztosan" előfordul természetes körülmények között gyakrabban is, nincs ebben semmi különös." Ez egyébként lehetségesnek lehetséges. Kimérák a természetben is jönnek létre (pl. a 2009-es H1N1-influenza vírusa), de a jelenlegi ismereteink nem zárnak ki alternatív lehetőségeket sem (laborbaleset).
  • Az RmYN02 beszúródása PAA (9 nukleotidos kód); a SARS-CoV-2-nél PRRA van az S1-S2 határon (12 nukleotidos kód); P=prolin, A=alanin, R=arginin.
  • Egy érdekes, hosszú elemzés a témában, végigvesz mindent, egy aranybánya. A szerző bizonyos Yuri Deigin. Mint írásából kitűnik, az "odakombinálódott" elmélettel az a különös, hogy a SARS-CoV-2 esetében nem egyszeri rekombinációról van szó. A SARS-CoV-2-t természetes produktumként csak több, rekombinációt eredményező véletlen találkozással lehet magyarázni (egyszerre fertőzött állati egyed egyszerre fertőzött sejtjében) az RaTG13 denevérCoV, a P2V/2017-es és a (2019-es) MP789 tobzoska-CoV koronavírusok között, akkora a "filogenetikai rendetlenség". A SARS-CoV-2-nél az S-fehérje receptorkötő doménje, vagy éppen az ORF1ab génje esetében is, eltérő pontokon van hasonlóság az RaTG13-mal egyfelől, és a tobzoska-CoV-okkal másfelől. De a többször rekombinációs magyarázat még mindig nem magyarázza a furin hasítási hely történetét...
  • Apropó, koronavírusok furin hasítási hellyel, itt van egy ábra az imént idézett forrásból. Szóval van jó pár ilyen, köztük a MERS és az OC43 is, de ezek nem a SARS-CoV-2 igazán közeli rokonai (a MERS tevékről ugrott, az OC43 pedig szarvasmarhákról) - lásd a felé mutató rózsaszín nyalábot az egyébként sárga kvadránsban alább. További filogenetikai rendetlenség.

sarscov2_coronaviruses_with_furin_cleaveage_site.png

  • Kísérletek, ahol furin hasítási helyet illesztettek be laborban SARS- és más releváns koronavírusokba. 2006 (USA). 2008 (Japán). 2009 (USA). 2015 (Hollandia)2019 (Kína). A zárójelben közölt országinfók legelőször is annyiban érdekesek itt, hogy ezt a beillesztést nem egy helyen csinálták már meg laborokban, és nem egyszer, és nem is csak tegnap. Az utóbbi, a kínai eset pedig közel van érdeklődésünk helyéhez, és ott például konkrétan HKU4-es denevér-CoV-ba ültették be a furin hasítási helyet.
  • Az RaTG13-vírus fellelésének helye is megvan közben az itt tárgyalt tanulmányban: a Jünnan tartománybeli Puer városa alá tartozó Mocsiang megye, egy ottani bánya.
  • További fontos eleme a Deigin-féle cikknek a 2002-ből, Ralph Barictól és csapatától eredő cDNA (complementary DNA=egyszálú RNS-ből szintetizált DNS) technológia rövid leírása, amivel szintetizálhatók/klónozhatók és szerkeszthetők RNS-vírusok, és amivel már 2003-ban dolgoztak a SARS-on is. Példaként íme, egy 2006-os spanyol kutatás SARS cDNA-klónnal.
  • Baricék a cDNA-technológiát tökélyre vitték, és eljutottak a "no-see-um" (észrevehetetlen) szintetizálásig. És rendszeresen dolgoztak kimérákon sokakkal, így Shi Zhengliékkel is kollaborációban, például ismételve és variálva egymás kísérleteit.
  • Ezt a kollaborációt a 2014-2017-es amerikai GOF (gain of function) kutatási moratórium is ösztönözte.
  • További, a 2002-2003-as SARS-CoV-ot érintő laborbalesetek. Szingapúr, 2003. Tajvan, 2003. A 2004-es kínai incidens pedig nem egyszeri volt, hanem kétszeri
  • Mindebből egy lehetőség következik, ami mellett nem szól konkrét bizonyíték, viszont nem is söpörhető le az asztalról, ha fegyelmezetten gondolkodik az ember. Shi Zenglinek és az ő laborjának egy esetleges balesethez egyébként nem is feltétlenül kellett, hogy köze legyen. Az övéhez hasonló kutatások is tudnak járványszerűen terjedni egy szakmai közösségen belül. Az emberre közvetlenül veszélyes vírusok, köztük gain-of-function kimérák rutinszerű, növekvő számú laboratóriumban végzett szintetizálása pedig egészen bizonyosan kockázatos
  • Hogy a témával sokan foglalkoznak jelenleg, azt az internetes keresők forgalmából az alábbi egyszerű indikátorral mutatnám ki. Íme. Screenshotok két perccel ezelőttről, Bing és Google.

sarscov2_mojiangvirus_binggoogle_20200525.jpg

  • Hogy legyen itt más is közben. Epikurosztól jött ez a review előtti anyag. Immunválaszok vizsgálata. Amerikai tanulmány, 71 beteg vizsgálata. A páciensek heterogének és jól tipizálhatók. Egyharmaduknál alig van immunválasz. Elgondolkodtam, honnan ismerős az egyharmados arány kapcsolódó kontextusban? Innen: Shanghaiban a vizsgáltak egyharmadánál nem találtak kielégítő antitest-mennyiséget.
  • Kevesebb az extrémen korai koraszülött a dánoknál a kijárási korlátozások (és a járvány) idején. "The reasons are unclear", szóval lesz miért vizsgálódni.

2020.05.26.

  • Ezzel a tanulmánnyal kezdem, hogy a víruseredet kérdését ezúttal a természetes felbukkanás mellett szóló érvek kapcsán is vizsgáljuk. Marha-koronavírussal kísérleteztek a kutatók, szarvasmarha- és emberi sejtkultúrákon (pl. HRT-18-ason). A sejttenyészeteken való "áthaladást" követően a produktum-vírusok konszenzusos genetikai szekvenciája a várakozásoknak megfelelően eltért a sejtekkel való találkozás előttitől. Ami igazán érdekes: jó pár esetben megjelent egy SRRR furin hasítási hely az S-fehérje S2-es funkcionális elemében. Mivel ez evolúciós léptékkel gyors és konzisztensen végbement változás volt, a kutatók arra a következtetésre jutottak, hogy ezek nem "de novo" mutációk voltak, hanem olyan, nem-konszenzusos szekvenciák, melyek eleve jelen voltak, és a szelekciós nyomás hatására lettek konszenzusossá a víruspopulációban. Ebből két tanulság adódik: 1) ilyesmi megeshet laborban, ahogy itt történt; 2) megeshet a természetben is.
  • Wuhanban megcsinálták közben a sample poolingot (csoportban összekeverős tesztelés a hatékonyság érdekében), hogy 10 nap alatt mintát vegyenek mindenkitől, és gyorsan eredmények is legyenek, az újra-kitörést megelőzendő.
  • A D-vitaminról és hiányának jelentőségéről már sok tanulmány született, és alighanem lehet köze ennek az északi országokban élő sötétebb bőrszínű emberek rosszabb rizikószintjét tekintve is. Szó esik erről a svéd-szomáliak kapcsán is ebben a rövid elemzésben.
  • Kevesebben haltak meg ebben a szezonban az influenzától? Valószínű.
  • A WHO "azonnali második csúcsok" lehetőségére figyelmeztet. Az teljesen jogos észrevétel tőlük, hogy a "hullámok" alapvetően az emberek fejében létező fogalmak. A vírus szimplán csak terjed, folyamatosan, ahogyan tud. Viszont azért nehéz az ilyen figyelmeztetéssel eredményt elérni, mert a halottak számában a változás mindig késéssel követi az esetszám növekedését, az esetszám növekedése pedig késéssel követi a fertőzés terjedését, pláne olyan országokban, ahol nem tesztelnek eleget, és nem érdeklődnek az "enyhe" esetek iránt. Akár egy hónapnál több is lehet a különbség. Így aztán könnyű beleszaladni dolgokba.
  • Dr. Seheulttől közben itt van egyszerű, de nagyszerű formában az ábra, amit én kicsit bonyolultabban közöltem korábban, a COVID-19 hipotetizált mechanizmusáról az erekben.

sarscov2_rogerseheult_mechanism.jpg

  • Az NEJM-ből itt van egy jó tanulmány az erek patológiájáról. Kulcsszó az angiogenezis — a tüdő az erekben bekövetkező mikrotrombotikus események miatt gyakorlatilag új érpályákat keres a forgalom lebonyolítására.
  • Erős kritika a magyarországi járványhelyzettel kapcsolatban egészség-gazdaságtani szempontból (Molnár Márk Péter). A járvány betegei kapcsán olyan ráfordítások, amilyeneket más eü. problémáknál a politikának esze ágában sincs megtennie. Közben az intézményekben élő legveszélyeztetettebbek védelme gyengén sikerült, pedig olyan korai volt a kijárási korlátozásokról/kontaktredukcióról intézkedés, hogy a rengeteg ellátás elmaradása mint annak rejtett költsége, és az ehhez kapcsolódó egészségvesztés megkérdőjelezheti az intézkedés helyességét.
  • Mégiscsak lenne keresztimmunitás a humán koronavírusok között a T-sejteken keresztül...? Legalábbis azoknál, akiknél a SARS-CoV-2 kivált komolyabb immunválaszt B- és T-sejtekkel (van, akinél nem). Nem kicsit jelentős kérdés pl. vakcinafejlesztés, vagy akár a stratégiai kilátások értékelésének szempontjából. Elképzelhető, hogy korábbi humánkoronavírus-klaszterek jelentik a terjedés korlátját azokon a helyeken, ahol relatíve lassabb a terjedés? A SARS-CoV-2 terjedési hálózata a korábbi koronavírus-hálózatok közötti térbe ékelődik be? Ezt egyelőre csak merész hipotézisként vetem fel. 
  • Nigériában (Rivers State) szaglás- és ízlelésvesztéssel járó betegségben 11 halott, nyomoznak. SARS-CoV-2?
  • A nyércfarmi esetekből Hollandiában már hét lett összesen, most egy család - nyilván körbeadták, és talán csak az egyikük kapta a nyércektől.
  • Itt ausztrál kutatók mondják, hogy a laborbaleset-elméletet komolyabban kellene venni. Lehet, hogy a válasz kényelmetlen a tudósoknak, de nem lehet kényelmetlen a tudománynak — ez lenne lényegében az üzenet.
  • Mexikóvárosban az év első hónapjára 8072-vel haladja meg a szezonális átlagot a halálozás, közben a SARS-CoV-2 1655 halálesetet okozott. G.a.h. a különbözet felével így: +74346+n.
  • A hivatalos spanyol halálozási adatot közben lefelé revideálták, mert az áldozatok világszinten, nem-konzervatív módszerrel (de reálisan) százezres nagyságrendűre becsülhető alulszámlálása mellett nyilván pont ez kell most a tisztánlátáshoz... a politikusoknak. Indoklásul kétszer számolt esetekre hivatkoztak, és olyan esetekre, ahol nem volt PCR-tesztes megerősítés — az utóbbi indoklás alapján utólag ezt csinálni elég sunyi húzás. Az adatok professzionális káoszosítását bejelentő tisztviselő, Fernando Simón hétpróbás... ööö... tisztviselő. Ő volt az, aki még a spanyol járvány robbanásának pillanataiban sem látta, miért kellene a tömegrendezvényeket elkerülni. Ezennel az 1900 levont spanyol eset fele (csak a fele, a konzervativizmus jegyében) megy a járvány addicionális halálozásának kategóriájába. Szégyen. G.a.h.: +75296+n.
  • A vízben és talajban éldegélő, de azért embert fertőzni is képes Chromobacterium violaceum, mely pl. a violacein nevű antibiotikumot is előállítja, vírusölő faktorokat is kiválaszt (CbAE-1 és CbAE-2), melyek hatékonyak a SARS-CoV-2, a dengue, a zika és a HIV ellen is például, egy új kutatás eredményei szerint (h/t Epikurosz).
  • Az ilyen kutatások miatt (itt történetesen a leronlimab szerepéről gyulladáscsökkentésben, CCL5 és IL-6 csökkentésére) valószínűleg jobb később megbetegedni a koronavírustól, ha nagyon muszáj. Majd akkor, ha már lezajlott sok randomizált kontrollvizsgálat, és kifinomultabbak lesznek a kezelési protokollok. Egy ilyen komplex betegségnél ez sokat számíthat, pláne kumulatívan.

2020.05.27.

  • Leporoltam egy kicsit a 2009-2010-es H1N1-es aktát, mert most már van értelme nagyobb ívű összehasonlításokat tenni, úgyhogy ma az első egypár pont erről szól, aztán vissza a SARS-2-eshez. A H1N1 első tizenhét hónapjában (2009. áprilistól 2010. augusztusig) projekciók alapján 212200 haláleset (range: 105 700–395 600) volt hozzá köthető a légúti fertőzéssel közvetlenül összefüggésben, és további 83300 (range: 46 000–179 900) a fertőzéssel kapcsolódó kardiovaszkuláris kondíciók miatt. Úgy, hogy a H1N1-et nem igazán próbálták feltartóztatni (összesen volt 18500 laboratóriumi teszttel megerősített haláleset 2010 augusztusáig). Ez azt jelenti, hogy a SARS-CoV-2 tizenhét hónap alatt lazán hozta, sőt túlszárnyalta ezt a szintet minden erőfeszítés ellenére (bár egyes politikusok, rettenthetetlen menedzserek és egyéb "influenzerek" azért dolgoztak ezeknek az erőfeszítéseknek az aláásásáért, mint láthattuk számos alkalommal).
  • Nagy különbség a H1N1-nél, hogy ennyi haláleset ott minden valószínűség szerint jóval nagyobb számú esetből adódott, a SARS-CoV-2-éhez képest legalább egy, de inkább két nagyságrenddel kisebb esethalálozási arány mellett.
  • Ugyancsak nagy különbség a H1N1 esetében, hogy az áldozatok mintegy 80%-a lehetett 65 év alatti. Köztük a terhes nők fokozott kockázatnak voltak kitéve. (Egészség-gazdaságtanosok ilyenkor nekiállnak a várható hátralévő életévek értékét tekintve kalkulációkat végezni, Disability-Adjusted Life Years stb.)
  • Vérrögökkel itt is voltak gondok a H1N1-nél is, bőven.
  • Még a tengeri vidrák is elkapták a H1N1-et, pl. Washington államban sikerült ezt náluk kimutatni. Arról jut eszembe, ami most a nyércekkel történik Hollandiában.
  • Visszatérve a SARS-CoV-2-höz, újabb genetikai tényező szerepéről vannak kutatási eredmények, miután az Egyesült Királyságban feltűnt, hogy a demencia szignifikáns komorbiditás volt COVID-19-nél. Így derül fény az ApoE e4 genotípus kockázati faktor voltára.
  • Vajon mi folyik Venezuelában? Az Orinoco folyón kívül. Egész Dél-Amerika megborulóban éppen, náluk meg a nyomor közepéből szerény kis jelentések jönnek.
  • Így néz ki a járvány terjedése, pl. akár napjainkban is. Temetés (nem koronavírusos elhunyt temetése), összejönnek családok stb.
  • Ez egy nagyon jó cikk arról, hogyan lenne enyhíthető a járvány terhe, de a legjobb megoldást kihagyja a számításból: a járvány felszámolását.
  • Információk arról, hogyan blokkolja a veleszületett immunválaszt a SARS-CoV-2, lehet kapaszkodni. Tanulmány. A fő hisztokompatibilitási komplex (MHC, Major Histocompatibility Complex) részét képező gének termékeiként a sejt felszínén jelenlévő, antigén-prezentáló molekulákat hatástalanítja (MHC-I), és így a fertőzött, de fertőzöttként meg nem jelölt sejtek ellen nem lép fel az immunrendszer citotoxikus T-sejtekkel. Idézek egy kicsit eredetiből is, mert virológiailag figyelemre méltó: "Here, we show that the viral protein encoded from open reading frame 8 (ORF8) of SARS-CoV-2, which shares the least homology with SARS-CoV among all the viral proteins, can directly interact with MHC-I molecules and significantly down-regulates their surface expression on various cell types." Szóval ez az ORF8-as leolvasásikeret-szekvencia is érdekes, új, patogenitást fokozó kis fejlemény, indítótól a záró kodonig.
  • Az amerikai Vöröskereszt egy kommunikációs vezetője hunyt el 51 évesen COVID-ben, hosszú betegség után. Talán éppen ő volt a százezredik az Egyesült Államokban — ezt nem kutatóként teszem hozzá.
  • Cseljabinszk, Oroszország. Itt eddig 18 halálesetet nem számoltak az "alapbetegségekre" hivatkozva az orosz adatmágusok. G.a.h.: +74364+n.

2020.05.28.

  • Klaszterek Magyarországon. Miközben csendesen csordogál járványunk csermelye, és napról napra hasonló számok jönnek az új esetekről szóló jelentésekben — ami a járványmatematikával nincs egyébként annyira összhangban, pláne kijárási korlátozások után, és nagyon pro-aktív tesztelés és kapcsolatkövetés nélkül, ugye —, hírek két friss klaszterről. Buják, Nógrád megye, honvédségi üdülő. Budaörs, óvoda/bölcsőde. Pár nappal korábbról ott a piliscsabai klaszter is. Ha valakinek kétségei lennének: ez tehát ugyanaz a vírus, mint amelyik a világban máshol is terjed, méghozzá gyorsan, ha hagyják. Kérdés: Mi állítja meg egy klaszter létrejöttét például egy tömött budapesti szórakozóhelyen? Amilyen van már jelenleg is, a nagy fellazulás eredményeként.
  • Emlékeztetőül: az Egyesült Államokban Trump február 2-án mondta, hogy "We pretty much shut it down coming in from China." Nem volt az olyan régen.
  • Remek cikk Dagesztánról és Csecsenföldről a BBC orosz kiadásától. Előbb a Moszkvából hazaözönlöttek hozták a vírust. Aztán nekik körbe kellett mindenkit látogatni, mert a szokás úgy diktálja, ha már otthon járnak — úgyhogy nem tartottak kéthetes önelszigetelést. Aztán jöttek a szokásos nagy esküvők és még inkább a temetések. Három napig szorosan együtt, akár ezer ember is, ilyen alkalmakon. Utóbbiakon nem megjelenni elfogadhatatlan tiszteletlenség, ez viszont jól előreláthatóan a fertőzés terjedéséhez vezetett. Az eredmény komoly átfertőződés, de legalább a helyi közösségek erősek, megszervezik a saját válaszadásukat valamilyen szinten. Családok, falusi tanácsok (dzsamatok) és szorokovkák (Сороковка; ami lényegében karanténbrigádnak felel meg szó szerinti fordításban).
  • A vérrögök a tüdőben, ezúttal fekete-amerikaiak boncolása nyomán. A tanulmány maga.
  • Egy egészséges, huszonhét éves ember is meghalhat COVID-ben.
  • Közben egy még jobb oktatóvideó a renin-angiotenzin rendszerről, mint amiket eddig linkeltem. a sheddase (kb. "leválasztáz") enzim szerepét is mutatja az ACE2 aktív, AT-II-est célzó formájának felszabadításában a transzmembrán elhelyezkedésű fehérjemolekuláról.
  • Ma láttam az RTL Klub híradóját, ahol felvetették, hogy Dzsudzsák Balázs azért szeghetett meg karantén-előírásokat, mert diplomáciai útlevele van, és akkor "diplomáciai mentességet élvez". Nos, nem. A diplomáciai útlevele természetesen nem mentesíti jogszabályok betartása alól sehol, Magyarországon pedig a diplomáciai útlevelét főként arra használhatja, hogy igazolja a személyazonosságát, ha kell, és csak az van nála. Azért az, hogy Dominic Cummings megúszhatja Angliában, még mindig jobban meglep.
  • Minneapolis, az ereje teljében lévő Iszlám Államot idéző rendőri erőszak, zavargások. Elképesztő ezt így összehozni egy járvány közepén. A rendőrök által meggyilkolt George Floyd egyébként étteremben dolgozott, és a korlátozások idején elvesztette az állását, úgy hírlik, ezért volt az utcán, amikor belekötöttek.

2020.05.29.

A nap fotója kezdésnek: Khalid Abdullah (Reuters). Houthi járőr Szanaában, Jemenben. Már Szíriában is láttam, hogy a harcoló feleknél alapfelszerelés az eü. maszk.

sarscov2_yemen_militia.jpg

  • Mint ismeretes, Oroszországban Moszkvából vitték haza a fertőzést sokan az ország távoli szegleteibe, pl. a Kaukázusba, sőt még a határokon túlra, Közép-Ázsiába is, a belső, illetve poszt-szovjet kvázi-belső migrációból, miután a korlátozások enyhültek. Most India van soron, jön a lazulás, mennek az emberek ki a városokból, az ottani belső migrációból, és olyan helyekre viszik a vírust, ahol az emberekből még csak számok sem lesznek, ha a járvány áldozatául esnek.
  • Talán mondani sem kell, a kieső eü. ellátás miatt is van halálozás Indiában (is). Ez a cikk egy dialízises esetet említ. G.a.h.: +74365+n.
  • Az Egyesült Államokban is kiürül az eü. rendszer, és elmaradnak a betegek, részben önszántukból, részben az elektív beavatkozások, részben egyéb terápiás kezelések leállása miatt.
  • Az 4,5 éves mozgó átlagot meghaladó halálozás Magyarországon, EuroMOMO. Vetettem az adatokra egy pillantást, és a következő a helyzet: a tavalyi év 48. hete óta van a mutató pozitív tartományban, nyilván lehet ez influenza és egyebek miatt. Az idei 9. héttől a 16. hétig egy sztenderd eltérésen felüli az állás. Ez a közelében sincs az olasz vagy a belga helyzetnek, nyilván, de azért igen figyelemre méltó, azt mondom. A 12. héten pl. 1,91 az érték; 65 év felettiek esetében pedig 2,04. Az volt március vége. Amikor kevesebben voltak az utakon, és ez a szezonális átlagot jelentősen alulmúló közútibaleset-számot produkált az év első négy hónapjában, úgy, hogy abból igazából csak másfél hónapra voltak érvényesek a korlátozások).

sarscov2_hungarymortalityzscore.jpg

  • Közben járványunk csermelye csendesen csordogál továbbra is, az elmúlt három nap eredménye tesztelt új eseteket tekinte +22, +23, +25, de most majd jön a hétvége, és hát ilyenkor a vírus is tudja, hogy nem illik terjednie stb. Kieg. május 30-án: a tippem "az adatok lenyugvásáról" nem egészen jött be, szombatra +26.
  • Tanulságos adatok Érdről: 80 teszt, 66 eset, 6 halott a mérleg május 24-ig bezárólag.
  • Adatok arról, hogy a korai hidroxiklorokinos kezelés jó lehet. A korai. Azaz nem a retardált tanulmányok által tesztelt késői. További adatok a klorokin hasznosságáról, egy másik tanulmányban. (Preprintek.)
  • A nagy Lancet-féle HXQ-tanulmányról pedig, amelyik kihozta, hogy a HXQ nem is jó... ööö... már megint zavartan dörzsölgetem a szemeimet, mert az ott használt adatok tényleg komolytalannak tűnnek. Shitty science strikes again?
  • Ezen a ponton kénytelen vagyok csúnyákat gondolni, mert az bizony érdekes tény, hogy a HXQ a maláriánál és a lupusnál közben működik, ez pedig jó ideje adott tömeges használatot jelent. 
  • A CNN minneapolisi tüntetésekről tudósító stábját se szó, se beszéd, letartóztatták, élő adás közben, miközben Trump a tüntetők szétverését követeli a Twitteren. Sajnos a következő választás az Egyesült Államokban már tényleg a demokráciáról fog szólni, ez fejeződik ki abban, ahogyan különböző szereplők viselkednek. És bár Trump levitte a mércét mélyre, ez annyival lejjebb viszi még onnan is, hogy az esemény ún. demonstrációs hatása globálisan érezhető lehet majd. Magyarán felbátorítólag fog hatni sok rezsimre világszerte.
  • Jemenben a Save the Children szerint kb. 400-an halhattak meg az elmúlt héten csak Adenben. Ez +300 konzervatívan nézve a hivatalos adatokon felül, amik egy polgárháborús ország esetében nem sokat érnek. G.a.h.: +74665+n.
  • Palkó Judit háziorvos kitüntetése, miután az iráni hallgató esetében ő kapcsolt kellően gyorsan, hogy ez koronavírus lesz, annak idején, még februárban. Gratulálunk!
  • Kínai közlemény szerint a Huanan Seafood Market inkább szuperterjesztős incidens helyszíne volt, mint a Ground Zero, és ezt alapvetően nem nehéz elfogadni egyéb, ráutaló bizonyítékok alapján. A legfőbb új információ, hogy a piacon talált állatokból vett minták közül egyik sem volt pozitív a vírusra.
  • Ha turistaként COVID-beteg leszel, Ciprus ingyen eü. ellátást biztosít.
  • Oroszországban Moszkva és környéke esetében beismertek több száz korábban koronavírusosnak be nem számított halálesetet (+922), de ez a nemzetközi adatszolgáltatásban egyelőre nem jelent meg. Ha majd megjelenik, akkor levonom a g.a.h.-ból.
  • Egy jó cikk a koloniális mentalitás szerepéről abban, ahogy a nyugati országok benézték a járványt, és azon túl még a kérdés egyéb vonatkozásairól is.

2020.05.30.

  • A Florida Today beszerezte információkikérés útján az idehaza kérés nélkül is megosztott egyéni alapbetegség-adatokat, köztük a 25 legfiatalabb floridai áldozat alapbetegségeiről is mindent. A tézisük persze az, hogy ezek az emberek amúgy is rossz állapotban voltak, csak hát én nem tudom, hogy valakinek az asztma miért lenne elég ok a halálra önmagában, vagy mondjuk a szteroidokkal kezelt látóideggyulladás, vagy hogy mi van azzal a négy beteggel, akiknél semmilyen alapbetegség nem volt, de még a diabéteszeseket sem gondolnám effektíve halálra ítéltnek. Egy betegnél az influenza A-t sikerült kimutatni, pontosabban csak azt, úgyhogy őt is leírták nem "tisztán" koronavírusos halottnak. Az érvelés lényege, ha jól értem, az, hogy "ezeket az embereket felesleges védenünk, mert ha védenénk őket, akkor nem halnának meg". (Így néz ki a fasizmus 2020-ban.) A több esetben is megfigyelt hiperlipidémia annyiban mindenképpen érdekes, hogy az LDL-koleszterin és a trigliceridek jelentőségét mutatja COVID-19-nél, ahogy azt eddig is hipotetizálni lehetett. 
  • Ugyancsak Florida. Több ottani újság is megírta, hogy vannak adatok, amikből egyesek megpróbálnak kihozni valamit, pedig nincs is ott semmi látnivaló. Ha az ember bírja cérnával, a végén még az adatokig is eljut, és naná, hogy van ott látnivaló. Ennyire ugrott meg Floridában a tüdőgyulladásos + influenzaszerű tünetek nyomán történt halálesetek száma január 20. után valamikor (talán április környékén, nehezen leolvasható az ábráról) — a fekete vonal jelzi, egyértelműen a szezonális átlag fölé megy.

sarscov2_floridapneumonia.jpg

  • A HXQ+cink jól működött egy texasi idősgondozóban is, korán kezdett kezelésként, az első pozitívra tesztelt személy tüneteinek jelentkezése után, azzal, hogy gyakorlatilag profilaxisként (PEP) adták a többieknek.
  • Indiában is vannak kormányzati adatmágusok, naná. Ezt a cikket anno nem linkeltem. Május 7-ig a delhi Manohar Lohia, a Lady Hardinge Medical College és a Delhi and Jhajjar AIIMS kórházak 116 COVID-os halálesetet jelentettek, de a szövetségi állami kormányzat egy nagyon független bizottsággal is megvizsgáltatta az eseteket, hogy csak az "elsődlegesen" a koronavírus miatt elhunytakat számolják aztán, és így lett a 116-ból 33. G.a.h.: +74748+n.
  • Nagyon jó összefoglaló Trump fenyegetőzéséről a WHO-ból való kilépéssel kapcsolatban.

2020.05.31.

  • A Lancet-tanulmányról, amelyik kihozta, hogy a HXQ még veszélyes is lehet. Az egyik szerző konkrétan start-up vállalkozó, és orvosi adatok szállításában utazik. Az adatai pedig komolytalanok.
  • A koronavírus rejtett halálozásának egy további aspektusa: ha valakit koronavírusosan operáltak, 30 napon belül a szokásosnál nagyobb eséllyel hal meg, pl. DIC vagy tromboembóliás esemény következtében; 14,9% helyett 23,8% a 30 napon belüli mortalitás.
  • Tüntetések, zavargások + gyújtogatás és fosztogatások is, az Egyesült Államokban többfelé. Ez így biztosan hatással lesz a járvány terjedésére. Louisville, Kentucky: egy rendőr gázpatronnal az NBC riporterét lőtte meg teljesen tudatosan. Már a Bellingcat is foglalkozik a jelenséggel. Mostanra lőttek külföldi újságírókra is. Egy másik riportert megvakítottak. Trump közben lehetővé teszi az amúgy is egy paramilitáris erőre emlékeztető rendőrségnek, hogy katonai eszközöket szerezhessenek be korlátlanul. Újabb módon tesz alapvető hozzájárulást a közegészségügyi katasztrófához az Egyesült Államokban. Egyben azt is világosan kifejezi, melyik közszolgáltatásba fektet szívesebben a hatalmi elit, az emberek gyógyításába, vagy a fegyelmezésükbe.
  • A koronavírus mellett nem volt egyszerű a felkészülés, de tegnap sikerült a SpaceX élőszemélyzetes indítása.
  • Más: a Wastewater-Based Epidemiologyról (szennyvíz-epidemiológia) bővebben ebben a disszertációban (Meleg Edina, PTE). Érdekes volt megtudni, hogy már az 1960-as években megtörténtek az első hazai szennyvíz-virológiai vizsgálatok, a gyermekbénulás elleni oltásokhoz kapcsolódóan, ezekkel az eredményekkel egészítve ki az oltóprogram értékelését.

2020.06.01.

  • Floridával már két napja foglalkoztam, és most már a CDC-től is volt, aki elismerte, hogy szignifikáns adatokról van szó a szezonális átlagot meghaladó tüdőgyulladásos halálozások esetében. Kb. +300 esetről, akiket nem teszteltek koronavírusra, de minden bizonnyal a járvány áldozatai. Senki nem akarta eltitkolni ezt egyébként. Mutatja viszont, hogy mennyire hajlamosak vagyunk inflálni az influenzaadatokat, mivel teszt nélkül hagyományosan automatikusan oda húznak be minden tüdőgyulladásos halálesetet. G.a.h.: +75048+n.
  • A koronavírus részben genetikai okokból, részben gazdasági körülményekkel és társadalmi egyenlőtlenségekkel összefüggésben arányon felül öl a fekete-amerikaiak és az őshonos népesség körében. Projekciók alapján azonos (lefelé nivellált) esethalálozási arányok mellett vagy tizenötezer nem-fehér amerikai lenne még életben.
  • Svédország továbbra is pocsékul áll, vezető helyen az egymillió főre jutó napi halálesetek számában.
  • Európai arisztokrata bulika Spanyolországban, fertőzöttekkel.
  • Fontos trend. Görögország a briteknek nem nyitja ki egyelőre a kaput. Dánia és Norvégia Svédországgal szemben folytat hasonló politikát, tekintettel a járványügyi helyzetre. Remélhetőleg ez fontos ösztönzőt jelenthet majd hülyepolitikusok és hülyejárványügyisek számára, hogy a járvány felszámolásának szükségességéről elgondolkodjanak.
  • Németországban és Hollandiában már permanens szennyvíz-megfigyelő rendszerben gondolkodnak, hogy korán észleljék, ha a koronavírusos esetek száma valahol megugrik. 

Holnaptól új bejegyzés következik majd.

53 komment

A koronavírus-járvány sűrűjében III.

2020.04.26. 09:41 :: Marton Péter

 Előzmények (korábbi kutatási jegyzeteim a témában):

2020.04.26.

  • Belgium készül a korlátozások lazítására. Mi baj történhet? Abban az országban, ahol egymillió főre vetítve a legmagasabb a koronavírusos halálozás a világon (San Marinót mint miniállamot nem számítva). Egyébként, jut eszembe, Nyugat-Európából Belgium delegálta népességarányosan a legtöbb külföldi harcost az Iszlám Államba.
  • San Marinóban a lakosságnak több, mint egy ezreléke halt meg a járványban mostanra.
  • Az első tíz itthoni elhunyt áldozat egyikének története a lánya elmondásában. Figyelemre méltó állítás például: "szörnyülködve és felháborodva nézem a koronavirus.gov.hu oldalon az édesanyám adatait, aki a második sorszámozású 65 éves nő (lenne) a táblázatban, és akinek az “Alapbeteség” nevű oszlopba beírták, hogy rosszindulatú daganata volt. Nos, ez nem igaz. Az én édesanyám nem szenvedett semmilyen más betegségben. Ezt a 8 napos kórházi tartózkodása alatt többször is, több orvos elmondta a telefonban amikor az állapotáról érdeklődtem. Elhalálozása után a patológus is megerősítette, hogy semmilyen más betegséget nem találtak nála, ennek ellenére a halotti bizonyítványba - ki tudja miért -, még ez a plusz alapbeteség is bekerült." A forrás megítéléséhez: az oldal kezelői érdekeltnek mutatkoznak a teljes körű áttekintésben, így nem csak rossz dolgokat említő történetek kapnak helyet, lásd például ezt.
  • A koronavirus.gov.hu-n közben egy 37 éves nő az elhunytak között, akinek leírták alapbetegségeként az extrém elhízást. A 40 feletti BMI (Body Mass Index) dokumentáltan kockázati faktor COVID-19-nél, de ezt így, individualizált adatként közölni rituális megalázása az érintettnek a rejtélyes értelmi szerző kedvéért, aki ilyenformán kényszeresen hajtogathatja, hogy az áldozatok már amúgy is félig halottak voltak.
  • A Portfolio beszámolója egy fontos prezentációról. Idézem: "Az is eldőlt a szakemberek visszajelzése alapján: alapvetően más járványvédelmi stratégiára van szükség Magyarországon, a kontaktszám manipulálásán alapuló stratégiák (a korlátozó intézkedések esetén a húzd meg - ereszd meg stratégia) nem tudják ugyanis megoldani a jelenlegi helyzetet. Az új, kombinált stratégia elemének kell lennie a sokkal több tesztelés és hatékonyabb kontaktkutatás." Wow. Csak hónapokon át kellett mondanom, és már meg is történik! Talán!
  • Ugyanonnan: hazai worst-case scenario 2,5 millió fertőzöttel a csúcson.
  • Még mindig ugyanonnan. Egész Európának szól a "gratuláció" az alábbiak kapcsán: "Az Európai Betegségmegelőzési és Járványvédelmi Központ áprilisi jelentése szerint a fertőzöttek 84-92%-a nem kerül detektálásra az ellátórendszerben, míg a megerősített COVID-19 esetek aránya az ellátórendszerben 7-12% lehet." 
  • A WHO is felhívta rá a figyelmet, hogy "vanantitestyeneki =/= indestructiblebyfire". Majd ettől hülye emberek kiakadtak, és a WHO ezért végül visszavonta az anyagot, és egy langyos üzenettel helyettesítette azt. Szomorú ez, úgy, ahogy van.
  • Az első, február 6-i, visszamenőleg azonosított áldozat az Egyesült Államokban hirtelen szívhalált halt, miután előtte influenzaszerű tünetei voltak. 

2020.04.27.

  • A kórház-kiürítések következményei. A nyílt hasi sebbel hazaküldött, és azóta meghalt beteg kapcsán nehéz teljes elkerülhetetlenségről beszélni úgy, ahogy a végstádiumú daganatos betegeknél az. (G.a.h.: +20311.)
  • Interjú egy magyar pulmonológus, "koronaosztályos" orvossal. Másodállásos munkára lehetőség most nincs, ami racionális a fertőzésterjesztés korlátozása érdekében, viszont megélhetési gondokat okoz. A szabadságot pedig a járványműszak közepette is ki kell venni, hogy a járvány vége után is lehessen folyamatosan dolgozni a bepótolandó vizsgálatokon, műtéteken.
  • Koronavírus-fertőzés hollandiai nyércfarmon. Volt már kutya, macska, tigris is. Ez a koronavírus rutinosan ugrál emlősök között.
  • Ahogy influenza és más fertőzések után is, SARS-CoV-2 után is előfordulhat (ritkán) Guillain-Barré-szindróma (GBS), a perifériás idegek ellen forduló immunreakció mint autoimmun rendellenesség. Az egyik legkellemetlenebb következménye, ha ez kihat a légzőizmokra, és valaki ezért kerül (vagy kerül vissza) gépi lélegeztetésre.
  • Előremutató elemzés a Válasz Online-on. "Rengeteg jelzés érkezik arról, hogy ha valakinek nincs 38 fokos láza és nem panaszkodik erős légzőszervi tünetre, akkor nem tesztelik. Amíg az emberek jó része otthon ül, addig a vírus átadásának kisebb a veszélye. Ha viszont az emberek kimozdulnak otthonról, akkor a rejtett esetek helyi járványokat indíthatnak el, ezért egy agresszív járványkezelési szakaszba kell átlépni – ahogy erről Oroszi Beatrix, az NKK Londonban járványügyi mesterdiplomát szerzett szakmai vezetője beszélt. (...) Magyarországon – szemben az olaszokkal, a németekkel, angolokkal és talán az osztrákokkal is – még nem tetőzött a járvány."
  • Ugyanitt érdekes a Kásler-Merkely konfliktus elemzése is, és pozitív értelemben megdöbbentő, hogy az egyetemi laboroknak az állami teszteléssel párhuzamos — és az állam által nem emlegetett — tesztelési tevékenysége milyen méretű.

2020.04.28.

  • Ecuadorban és Bolíviában közös, hogy a vezetőváltással járó külpolitikai orientációváltással (Ecuador: Rafel Correa  Lenín Moreno; Bolívia: Evo Morales ▻ Jeanine Áñez) a kubai orvosok is távoztak, és ezt megsínyli náluk az egészségügy.
  • Március 1-től április 15-ig Ecuadorban +7600 halálozás az azonos időszakban átlagos halálozáshoz képest, miközben csak 503-an haltak meg COVID-ben hivatalosan. Úgy, hogy az epicentrumban, Guayaquilben elég meleg van, ami ezek szerint nem akadálya a járványnak... E szerint a forrás szerint több halott is lehet; itt 8000 körüli szám jön ki csak Guayas tartományra, tehát nem is az egész országra. G.a.h. így: +7497 minimálisan; összesen +27808+n.
  • Az iménti forrásnál írják, hogy Ecuadorba is Spanyolországból repült a vírus, ahogyan pl. Argentínába is. 
  • Ha már a globális addicionális halálozással foglalkozunk, a Financial Times is kiveszi a részét a nyomozásból. A szigorúan konzervatív számítási módszeremmel ebből most nem tudok beszámítani semmit, viszont a cikk globális projekciója figyelemre méltó, miszerint lehet akár +117000 is a hivatalos adatokon felül. Ezért írom oda mindig a saját mérlegemnél, hogy "+n".
  • Hogy jó hírek is legyenek: Új-Zéland és Szlovákia például elég jól állnak most. Új-Zélandon napok óta tíz alatt a felfedezett esetek száma, intenzív tesztelés mellett; klasszikus "hammer and the dance" figura.
  • Ukrajnában: (1) 1676 eü. dolgozó fertőzött, csak tegnap +100; (2) állami tisztviselő mondja ezt el a tévében a felelősség elkenése nélkül, hozzátéve, hogy ezzel sajnos világelsők, gondolom, az összes eset számához képest; (3) Kijev és Csernyivci a járvány központjai (ha tippelnem kell, Csernyivciben is köze van ennek a vendégmunkás-migrációhoz).
  • Ez az RNS-vakcinás fejlesztés ígéretes fázisban jár (bázis: Imperial College London). Egereknél a dózissal pozitívan korreláló mennyiségű IgG antitestet generált, és az IgG mennyisége ezek után a vírusneutralizációval is pozitívan korrelált.
  • Előrejelzés a német járványügytől (Christian Drosten): "Now, what I call the “prevention paradox” has set in. People are claiming we over-reacted, there is political and economic pressure to return to normal. The federal plan is to lift lockdown slightly, but because the German states, or Länder, set their own rules, I fear we’re going to see a lot of creativity in the interpretation of that plan. I worry that the reproduction number will start to climb again, and we will have a second wave."
  • Drosten hisz benne, hogy ha nem is gyorsan, de elvághatók a terjedési láncok. Csakhogy: "it can’t happen based on human contact-tracing alone. We now have evidence that almost half of infection events happen before the person passing on the infection develops symptoms – and people are infectious starting two days prior to that. That means that human contact-tracers working with patients to identify those they’ve been exposed to are in a race against time. They need help to catch all those potentially exposed as quickly as possible – and that will require electronic contact-tracing." (V.ö.: Magyarországon egyelőre a humán kapcsolatkövetés döcögős verziója van, úgyhogy fel kell majd kötni a gatyát.) Kieg.: friss tanulmány (Science), mely modellezésből hozza ki, hogy a pre-szimptomatikus transzmissziók elegendők a járvány fenntartásához.
  • A nyájimmunitás fogalmáról szólva fontos, még mindig Drostentől: "It assumes complete mixing of the population, but there are reasons – in part to do with the social networks people form – why the whole population may not be available for infection at any given time. Networks shift, and new people are exposed to the virus. Such effects can drive waves of infection." Hozzáteszem, hogy szerintem a nyájimmunitás nem lehet relatív fogalom: vagy van, vagy nincs. Influenza ellen sincs. Átoltással lenne elérhető, bár még úgy is csak akkor, ha a vírus evolúciója azt nem cselezi ki a kis genetikai csuszamlásaival. Az influenza évről évre megteszi; talán a koronavírus is képes lesz erre — meglátjuk.
  • Kell a célzott, pontosabban a potenciális szuperterjesztőket és a különösen veszélyeztetetteket célzó tesztelés a kapcsolatkövetős és a szimptomatikusakat szűrős mellé: "targeted testing might be best, for people who are really vulnerable – staff in hospitals and care homes, for example."
  • Más. Ez itt egy igazi rejtély jelen állás szerint. Toxikus sokk szindróma fellépése Kawasaki-szindrómás gyerekeknél (a Kawasaki előfordulása ritka, 8-67/100 ezer fő; Japánban viszont jóval magasabb, minimum kétszeres), orvosi sejtések szerint COVID-19 kapcsán. Figyelemmel követjük, kiegészítéseket beírok majd ide (h/t Epikurosznak; egy csomó fontos link a kommentek között.) Kieg.: ha minden igaz, itt az orvosi sejtés arra vonatkozik, hogy maga a Kawasaki a SARS-CoV-2-es fertőzés után léphet fel esetleg.
  • A rossz amerikai-kínai kapcsolatok miatt a Trumpli-adminisztráció azonnali hatállyal leállította az emberi transzmisszióra potenciálisan képes denevér-koronavírusok kutatásának finanszírozását. 
  • Fontos számok. Az Egyesült Államokban 7324-en foglalkoznak kapcsolatkövető munkával. Ha a lockdown megszűnik, 100-180 ezer főre lenne szükség... Adatok szövetségi tagállami bontásban itt. Jelenleg Észak-Dakotában áll csak rendelkezésre elegendő ember. New Yorkban 100 ezer lakosra 3 contact-tracer jut most. (Észak-Dakotában 32,8 jut 100 ezer lakosra, és a céljuk ennek a dupláját csatasorba állítani.)
  • Hogyan ne következtessünk nyájimmunitásra, Euronews edition: "A report, based on data from April 12-20, found that 35 per cent of app users have or have had COVID-19 (in Bergamo, Italy). The app only had data from 4 per cent of the province's 1.1 million inhabitants. But it was extrapolated to estimate that 381,000 people in the region have been hit by COVID-19, of which 62,000 are still projected to have symptoms. Having consulted virologists as part of the report, an estimated 10% of the population could be asymptomatic, leading to an estimated 45% of the population that could be affected by the virus, or nearly half a million people." App-felhasználók nagyon-nem-reprezentatív populációjából projektálni egy város népességére, majd önkényesen hozzácsapni közel 25%-ot, aztán még feljebb kerekíteni... Nehéz az ekkora böszmeséget sima újságírói hülyeségnek betudni :( 
  • Dr. Seheulttől kötelező néznivaló. A vérrög-képződésről. Az érfalak belső oldalán található endotheliális sejtek fertőződése nyomán a véralvadásba belejátszó von Willebrand-faktor szabadul fel, miközben az angiotenzin II. szintje is elszabadul a lekötött ACE2 miatt, és ez ér-összehúzódáshoz vezet. A mikrovaszkuláris elzáródások nyomán pedig... súlyos COVID-19-nél majdnem minden út a hipoxémiához és ARDS-hez vezet.
  • Tanulságos eset Tatabányáról: hogyan lesz "alapbetegsége" az embernek 41 éves koronavírusos elhunytként (mint eü. dolgozó, ráadásul).
  • Kis figyelmeztetés a tesztelési adatok nemzetközi összehasonlítgatásához: Kit hányszor teszteltek, hány emberre jutott x teszt. Nézni kell. Vagy például: amikor hozzáadják a számlálóhoz a tesztelésre vonatkozó adatot, az nem feltétlenül a tesztelés napja. Stb.
  • Eszembe jutott közben egy fontos érv a pro-aktív tesztelés mellett, kár, hogy nem korábban... Eddie Murphyt hívom segítségül:

eddiemurphy.jpg

A nap idézete, zárásnak: “It’s increasingly recognised that Covid-19 hasn’t read the textbook about what it should be doing as a respiratory virus.” (Dr. David Burgner, Melbourne, Ausztrália.)

2020.04.29.

  • Ez úton cáfolnánk, hogy az egészség és a gazdaság között kell választanunk a jelen helyzetben: ellátási zavarok az amerikai húspiacon tömeges megbetegedések miatt.
  • Az antitest-tesztek nem-kielégítő megbízhatóságáról, ha valaki nem figyelt volna.
  • 11854-el több haláleset az ötéves átlagnál az április 11-17-es időszakban az Egyesült Királyságban. A különbözet felét figyelembe véve g.a.h. +33735+n.
  • A D-vitamin hiánya súlyos COVID-19-lefolyást indikál, ez mindenképpen logikusnak tűnik. Azért a vonatkozó tanulmány húsz páciensen alapul, ahol 11 fő 75 év alatti intenzív osztályra felvett betegnek volt VDI-je (Vitamin D insufficiency).
  • Remek cikk arról, mennyi mindent lehetett volna előre sejteni a már endemikus humán koronavírusok, vagy akár az állati koronavírusok (PEDV, MHV) tanulmányozása alapján a bélrendszeri problémáktól a neurológiai hatásokig.
  • Német eredmények arról, hogy a gyerekek is éppen eléggé fertőzők lehetnek vírusszámot nézve, más korcsoportokkal összevetésben. Óvatosan az óvodákkal. Lásd alább az eredmények megoszlását — egy adatpont egy egyén; Christian Drosten megosztásában.

viralload_agegroups.jpg

2020.04.30.

  • A csökkenő kereslet miatt Kínának sem túl jó a helyzete. A gyártósoraik futhatnak már, de kinek szállítsanak?
  • Ha valakit zavarna, hogy az S&P 500 nem esett elég nagyot, itt elolvashatja, miért. Nem mindegy, ki a része az indexnek, és az ott megjelenő vállalatokon keresztül mely ágazatok.
  • Az Abbott cég fejlesztésében állítólag 99%-os szenzitivitással és ugyancsak 99%-os specificitással funkcionáló antitest-teszt válik május végére széles körben elérhetővé laboratóriumi használatra.
  • Dr. Roger Seheult ma is kötelező. Az ACE2 receptorok lekötésével szabadon ható angiotenzin II. miatt elszabaduló reaktív oxigénformák (szuperoxid, hiderogén-peroxid, hidroxilgyökök) szintjének változása is kárt okozó mechanizmus (oxidatív stressz) az erekben, mint azt kifejti. A COVID-19-et pedig inkább a vaszkuláris endothelium betegségének definiálja már, mint a légutakénak. A COPD és az asztma kevésbé tűnik kockázati faktornak, mint a CVD, a hipertónia vagy a diabétesz.
  • Dr. Seheult ma tart online szemináriumot a COVID-19-es klinikai tapasztalatokról, itteni idő szerint este 10-től.
  • Ez a cikk több okból is lenyűgöző. Madárinfluenza ügyében Kínában kutakodó amerikai orvos kínai kollégáival talál bizonyítékot egy gyomorégés-gyógyszer hatásosságáról COVID-19-nél, miközben számítógépes modellezés is kidobja az adott gyógyszert a vírusreplikációt akadályozni képes molekulák egyikeként. Ráadásul ez pont a "szegény ember gyógyszere". És a végén Dr. Callahan még örökbecsű tanulsággal is szolgál: "the famotidine lead underscores the importance of science diplomacy in the face of an infectious disease that knows no borders. When it comes to experience with COVID-19, he says, “No amount of smart people at the [National Institutes of Health] or Harvard or Stanford can outclass an average doctor in Wuhan.”" Kieg.: csodaszerként azért ne kezdjen gondolni erre senki, nem arról van szó, és persze mellékhatásai is lehetnek. COVID-terápiában konkrétan intravénásan használják, a szokásos dózis kilencszeresével
  • Misusztyin orosz miniszterelnök SARS-2-pozitív.

2020.05.01.

  • Mexikó: az amerikai piacra gyártó cégek, termelés lockdown és járvány közepette is, erőltetetten. Tizenhárom halott csak az autóüléseket gyártó Lear Corporationnél.
  • Egy NY-i orvos öngyilkossága. Nem lehet nem a járványhoz kapcsolni — így is szed áldozatokat. G.a.h.: +33735+n.
  • Az NYT az Egyesült Államokban is feltárta az addicionális halálozást a járvánnyal kapcsolatban több államban. Ha a hivatalos COVID-19-es haláleseteket mind addicionálisnak tekintjük (azonos időszak átlaga felettinek), és csak a különbözetet számoljuk, ami az után marad (nagyon-nagyon konzervatívan), abból ez jön ki: New Jersey: 3000; New York állam (NYC nélkül): 1700; Michigan: 600; Illinois: 700; Massachusetts: 500; Maryland: 500; Colorado: 300; összesen: 7300 (időkeret: március 8.- április 11.). G.a.h.: +41035+n.
  • A németek stratégiai elemzése az R0 alakulásáról: "ha az R0 1,3-ra emelkedik, már júniusra túlterheli az egészségügyi ellátórendszert a betegek tömege. Ha a reprodukciós arány 1,2-re emelkedik, akkor júliusra terhelődik túl a rendszer, ha pedig 1,1-re, akkor októberre nem lesz elég kapacitás a betegek ellátására".
  • Fontos cikk eü. dolgozók számára: a PEP (Post-Exposure Prophylaxis) elég jól működik hidroxiklorokinnal. Dél-Koreában 184 kórházi beteg és 21 eü. dolgozó zárt PEP-kúrát negatív vírusteszt-eredménnyel. A hidroxiklorokinnak nyilván inkább így van értelme, mint az intenzívre felvett betegeknél, ha egyszer a vírusreplikáció akadályozása a célunk. Mellesleg ezzel a járvány elvágásáért is lehet tenni, az eü. dolgozókénál szélesebb körben is.
  • Olaszországból származó adatok szerint a hidroxiklorokint szedő lupusos és reumás betegek között kisebb lehet a COVID-19 előfordulása. Ezt még figyelni kell majd, de érdekes lehetőség, ha a pre-exposure prophylaxis működhet, ezek szerint. Tartok tőle, hogy ezt gyógyszerkészletekkel nem lehetne fedezni globális szinten.
  • Jó cikk arról, hogy a profitmotiváció nem volt kompatibilis a SARS-jellegű járványokra való felkészüléssel, még a denevér-koronavírusok ismert fenyegetése mellett sem, és ezért a profitmotiváció helyett a jövőben talán más megoldást kellene találni majd az ilyesmire.
  • Cikk a járvány terjedésében fontos szerepet játszó klaszterekről, és a színterekről, ahol előfordulnak.
  • "Happy hypoxics". Új kifejezés azokra, akik az élettel nehezen kompatibilis véroxigénszint mellett is még egészen jól érzik magukat, és COVID-19-nél gyakran bukkannak fel. (Mondjuk kontrollálni érdemes lehet, hogy nem pl. paracetamoltól pörögnek-e.)
  • A COVID-19 nyomában lesz további rejtett,hosszú távú mortalitás is sajnos. Általános tapasztalatokról beszámoló ebben a cikkben: "After any severe case of pneumonia, a combination of underlying chronic diseases and prolonged inflammation seems to increase the risk of future illnesses, including heart attack, stroke, and kidney disease, says Sachin Yende, an epidemiologist and critical care physician at the University of Pittsburgh Medical Center. His team reported in 2015, for example, that people hospitalized for pneumonia have a risk of heart disease about four times as high as that of age-matched controls in the year after their release, and about 1.5 times as high in each of the next 9 years. COVID-19 might prompt “a big increase in these sorts of events,” he says." Különösen rossznak tűnnek azoknak a kilátásai, akik lélegeztetőgépre kerültek a kezelés során, mind kockázatok, mind felépülés tekintetében.
  • Brit klinikai adatokat összegző tanulmány. A lélegeztetettek 53%-a meghalt. És még sok más adat persze. Kórházban inkább idősebbek, és inkább a férfiak (aligha meglepő). CVD, diabétesz, COPD, asztma egyaránt jelentős komorbiditások; kövérség kockázat.

2020.05.02.

Eszembe jutott kicsit körülnézni, hogy a SARS(-1) idején volt-e jele a hiperkoagulációs problémáknak, hiszen a SARS(-1) is az ACE2-es receptorokra csatlakozott, és akkor a vaszkuláris endotheliumban is nyilván kárt tett. Hát, itt van például ez a 2005-ös tanulmány egy páciensről, akinél a jobb oldali tüdőartéria trombózisa következett be. Ugyanitt említik, mások eredményeiből, hogy megnövekedett APTI (aktivált parciális tromboplasztinidő) és D-dimer-szint a SARS-betegek 65, illetve 45%-ánál fordult elő. Egy szingapúri kórház betegei között 20,5%-nak volt mélyvénás trombózisa, 11,4%-nál tüdőembólia. Boncolási eredményeket is idéznek, ahol előkerült mélyvénás trombózis, tüdőartériás thromboembólia, egy esetben pedig infarktusok nyoma a szívben, a vesében, a lépben és a nyakszirti lebenyben. Úgy tűnik tehát, hogy ez a probléma már akkor is jelentkezett. (Érdekes ugyanakkor, hogy az itt idézett tanulmány szerzői az intravénás immunoglobulinos (IVIg) kezelés hatására is gyanakodtak a látottak magyarázatában.)

Erről az is eszembe jutott közben, hogy pl. az LDL-koleszterinszintet nem lenne-e érdemes megtanulmányozni egy kicsit a súlyos betegeknél. Erről nem láttam eddig adatot, de elég relevánsnak tűnik ránézni erre is.

Egy másik tanulmány, amit egyszer már előástam itt korrában, a SARS után csontnekrózistól szenvedő betegekkel foglalkozott, és miközben az ilyen betegek kortikoszteroidos kezelését gyanította a csontnekrózis egyik okaként, leírja, hogy: "In this study, most patients have both an external contributor to ON (corticosteroids, SARS) and thrombophilic and/or hypofibrinolytic coagulation disorder. The importance of coagulation abnormalities in the pathogenesis of ON has been noted for a long time. In 1974, Jones [] postulated that intravascular coagulation, activated by a variety of underlying diseases, is the likely final common pathway producing intraosseous thrombosis and necrosis." Azt hiszem, ez alapján lesz mire odafigyelni később a SARS-2-ből felépülőknél is.

Kutakodtam aztán tovább, és találtam egy jó tanulmányt a trombózis fellépéséről virális fertőzéseknél általában. Sok a meglepően feltáratlan dolog, ahhoz képest, hogy ezek szerint más vírusoknál is előfordul DIC. Például: "Respiratory tract infections increase the risk of deep venous thrombosis and possibly pulmonary embolism too [Smeeth et al., 2006]. Patients infected with the influenza A virus have been known to suffer disseminated intravascular coagulation and pulmonary microembolism [Davison et al., 1973; Harms et al., 2010]. In the recent outbreak of H1N1 influenza (‘‘swine flu’’), both thrombotic and hemorrhagic complications were reported." Persze míg a vírusos fertőzések kapcsán nagy általánosságban az egyik alapvető mechanizmus az IL-6, IL-1, IL-12 citokinok és a gyulladási folyamatok hatása (ennek nyomán pl. a von Willebrand-faktorok stimulálása), addig a SARS-CoV-2 esetében komplexebb, specifikusabb és súlyosabb az impakt. Kieg.: ez a cikk a citokinok alvadásszabályozó szerepéről az alvadásaktiválás kapcsán említi még az IL-2-t és a TNF-et (tumornekrózis faktor) is (közben más citokinek alvadásgátlóként hatnak). A legfőbb említett mechanizmus a szöveti faktor kifejeződésének stimulálása a szubendotheliális szöveti sejtek és a fehérvérsejtek felől, vagy éppen a vaszkuláris endothelium sejtjeinek felszínén is; ezek után a szöveti faktor eljátssza szokásos szerepét a haemostasisban.

  • Elgondolkodtató reflexió egy sürgősségi orvostól (Jeremy Samuel Faust, a Harvard Medical School oktatója is) az influenzás halálozásokról: "in four years of emergency medicine residency and over three and a half years as an attending physician, I had almost never seen anyone die of the flu. I could only remember one tragic pediatric case. Based on the CDC numbers though, I should have seen many, many more. In 2018, over 46,000 Americans died from opioid overdoses. Over 36,500 died in traffic accidents. Nearly 40,000 died from gun violence. I see those deaths all the time. Was I alone in noticing this discrepancy? I decided to call colleagues around the country who work in other emergency departments and in intensive care units to ask a simple question: how many patients could they remember dying from the flu? Most of the physicians I surveyed couldn’t remember a single one over their careers. Some said they recalled a few. All of them seemed to be having the same light bulb moment I had already experienced: For too long, we have blindly accepted a statistic that does not match our clinical experience." Ha valakinek még kétségei lettek volna arról, hogy a COVID-19 az influenzánál rosszabb-e... Azt azért nem nehéz dokumentálni persze, hogy vannak valószínűsíthetően influenzás (bár jellemzően nem tesztelt) halálesetek: lásd például itt, itt és itt.
  • Vágó Péter kiváló írása arról, hogy Európa következő két-három évében az européerség koncepciójára építők sajnos "kénytelenek lesznek empirikusan tesztelni, hogy az európai átlagember mennyire tartja fontosnak a szép eszméket akkor is, ha kimaradt a nyaralás és nem telik a legújabb okostelefonra". 
  • Így néz ki jelenleg az ENSZ Biztonsági Tanácsának munkája. Egy olaszországi, Brindisiből működő videokonferencia-rendszert használnak, persze ugyanolyan problémákkal, mint a hétköznapi emberek a Teams, a Zoom és társaik használata közben.
  • Egy érdekes link. A U.S. National Institutes of Health az Eco-Health Alliance nevű tudományos nem-kormányzati szervezettel (inkább csak kvázi-nem-kormányzati, úgy tűnik) és a Wuhan Institute of Virologyvel együtt történetesen gain-of-function kutatásban vett részt. Itt olvasható a projekt leírásaIdézet innen: "Aim 3: In vitro and in vivo characterization of SARSr-CoV spillover risk, coupled with spatial and phylogenetic analyses to identify the regions and viruses of public health concern. We will use S protein sequence data, infectious clone technology, in vitro and in vivo infection experiments and analysis of receptor binding to test the hypothesis that % divergence thresholds in S protein sequences predict spillover potential." Ennek részeként, úgy tűnik, létrehoztak kimérákat is, amilyen például az SCH014-es denevérkoronavírus és a SARS-CoV(-1) keresztezése volt korábban. Namármost ez azért érdekes, mert bár ez sem egy "füstölgő pisztolycső", ami nem-természetes, azaz laborbaleseti eredetre vallana a jelen pandémiát illetően, viszont így már két fura egybeesés is van a SARS-CoV-2 felbukkanása körül. A Wuhan CDC létesítménye 150 méterre a Huanan piactól, plusz egy amerikai-kínai finanszírozású gain-of-function virológiai kutatás a Wuhan Institute of Virologyben — ezek mellé jön a tőlük elvben független spill-over incidens az ismeretlen köztigazda és egy ember között. Hát, figyelgetünk majd erre továbbra is.

2020.05.03.

  • Hollandián belüli különbségek, Észak-Brabant vs. Groningen. Utóbbinál jóval kisebb a szezonális átlagot meghaladó halálozás. Alex Friedrich virológus volt ott a járványügyi válaszadás egyik fő szervezője, és ragaszkodott az enyhe esetek teszteléséhez is. Mint mondja: "“In the Netherlands, in our country, they said that diagnostics is interesting for statistics but not important for the fight against the disease. There I strongly disagree.”
  • Vajon nálunk az oldódó korlátozások kapcsán mennyire lehet számolni megkomolyodott tesztelési és kapcsolatkövetési megközelítéssel? Ha nem, úgy ez a vírus nagyon gyorsan tud szétterjedni. Vigyázó szemünket többek között Győr térségére, vagy éppen Fejér, Zala, Komárom-Esztergom, Veszprém és Csongrád megyékre vethetjük.
  • Egy cikk a komorbiditásokról, adatokkal New Yorkból; n=5700. "The most common comorbidities were hypertension (3026; 56.6%), obesity (1737; 41.7%), and diabetes (1808; 33.8%)." Komorbiditás nélküliek 6%, egy komorbiditással 6%, egynél több komorbiditással 88% a kórházba kerültek között. "The median score on the Charlson Comorbidity Index was 4 points (IQR, 2-6), which corresponds to a 53% estimated 10-year survival and reflects a significant comorbidity burden for these patients." Ugyancsak a kórházba kerültek között asztmával kb. 9%, COPD-vel 5,4%; megjegyzés: ez érdekes módon nem nagyon több, mint az asztmások és COPD-sek aránya a NY-i populáción belül. ACEI/ARB-rezsim és egyéb vérnyomás-csökkentő kezelés között nem látszik perdöntő különbség itt (ezúttal pár százalékkal jobb volt a mortalitás a non-ACEI/ARB-csoportnál). 

2020.05.04.

  • Egy cikk érdekességekkel a vaszkuláris endothelium funkcióiról. 96 ezer km érpálya a szervezetben.
  • Ugyanonnan, a korábban dr. Seheult által feszegetett oxidatív stresszhez adalékul: "Several factors that can increase the number of free radicals in the body include obesity, smoking, sleep deprivation, acute microbial infections, high glucose intake, and exposure to metals and air pollutants".
  • Megjegyzem, hogy a DIC nyilván a lélegeztetéses mozdulatlanság miatt is valószínűbben vezet stroke-hoz, trombózishoz, embóliához — az összes egyéb tényező hatása mellett.
  • Újabb anyag az átlagosat meghaladó halálozásról.
  • Német stratégiai anyag, epidemiológusoktól, nagyon jó, h/t Epikurosz. Az abszolút lényeg: "Complete eradication of the virus is possible in principle, but would require international coordination and immense efforts. Such a worldwide eradication cannot be achieved in the near future. Rapid infestation implies a massive overload on our health care system and a corresponding number of avoidable deaths. Therefore, neither of the two scenarios represents a viable option." Lefordítva: elvben véget lehetne venni ennek az őrületnek, de a világ országainak nagy részében ehhez vagy túl hülye a hivatalos megközelítés, vagy a jelenleg rendelkezésre álló erőforrásokkal nem biztosítható. A járványt elereszteni pedig... légyszi, azt neeee.
  • Ugyanott, a "controlled infestation" forgatókönyvről (a járvány terjedésének elengedése, de az eü. rendszer veszélyeztetése esetén a gyeplő behúzásával), vélemény: "Our models agree that, even with optimistic estimates of the number of unreported cases, this would take years and cause many deaths." Lefordítva: légyszi, neee. Vagy legalább ne nevezzük ezt stratégiának. Shit happens (of course), but not with our approval. We told you.
  • Amit javasolnak: "consistent containment". " It is possible that the number of new infections N will be reduced within weeks to such an extent that extensive contact restrictions can be replaced by efficient contact tracing. The more consistently measures are implemented, the smaller R becomes and the faster this can be achieved." Lefordítva: "Ha fenntartjuk a korlátozások egy részét, lelassulhat annyira a terjedés, hogy utána, ha nem dugjuk a fejünket a homokba, és készek vagyunk eleget nyomozni és telefonálni, akkor nagyon kevés eset legyen." (V.ö.: "the hammer and the dance".)
  • Bárhogyan minősítjük is a SARS-CoV-2 mutációs hajlamát, ahhoz eleget mutál, hogy az rt-PCR-teszteket azok célgénjeitől függően megnehezítse, és hogy azok fals negatívakat produkáljanak.
  • Epikurosz lelete: a magyarázat arra, hogyan fordulhatott elő, hogy egy brit klinikai tanulmány adatai szerint a betegek 33%-a meghalt, de csak 17%-uk került intenzív osztályra (n=16749). "Triázs".
  • Volt már a történelemben olyan Erasmus-diák, nem egy, aki Leuvenből ment Louvainbe tanulni, "vendégdiáknak". A kijárási korlátozások legújabb kori történetében pedig volt most már olyan ruházati üzlet is, amelyik a belga oldalon zárva volt, a holland oldalon pedig várta közben a vásárlóit.
  • Oroszország. Kórházakból ablakon kieső, előzetesen panaszt megfogalmazott orvosok, hárman. Ketten belehaltak, egy koponyatöréssel... kórházban. G.a.h.: +41037+n.
  • Francia retrospektív teszteredmények szerint már decemberben is COVID-19 volt náluk egy tüdőgyulladás. Az eset december 27-i (akkor került kórházba), úgyhogy addigra akár lehetett ez Kínából importált eset simán (akkor is, ha nyilván napokkal korábban kapta el egyébként). Viszont módszertanilag azért picit bizonytalan nekem az influenzateszthez vett minta előásása nyomán a PCR alkalmazása. Kapcsolatkövetés: a tünetmentes feleség egy kínaiak által üzemeltetett szusizó mellett dolgozott, de több konkrétum egyelőre nincs.

2020.05.05.

  • Tanzániai, kongói és madagaszkári államférfiak, úgy tűnik, közös vállalkozásba fogtak, és diplomáciailag marketingelnek egy madagaszkári gyógynövény-kotyvalékot, mely egy ürömféléből (Artemisia) készül történetesen — utóbbi malária ellen egyébként hatásos; használatos Artemisinin-based combination therapies (ACTs) keretében. Itt most COVID-19 ellen használnák — ha jól értem, húsz páciensnél tapasztalt csudálatos változások konzekvenciájaként.
  • Arról, hogy néz majd ki a digitális kapcsolatkövetés az Egyesült Királyságban, jelenleg Wight szigetén tesztelik a rendszert. Készülék-ID (nem személyes név) alapján, elmúlt 28 (!) napon belüli bluetooth-érintkezés rekordjából kiindulva értesít a rendszer készülékeket az önkéntesen jelentett tünetek nyomán, önizolációra szólítva fel, majd teszteredmény alapján további értesítést küld, ahogy kell.

2020.05.06.

  • A Válasz Online lehozott egy olyan kritikán alulian buta cikket, hogy csak pislogok. Haljanak meg inkább a gyengék, hogy lapozhassunk, kb. ennyi az üzenete (járványfasizmus), amit olyan sekélyes elemzésből hoz ki, mintha valamikor hónapokkal ezelőtt tájékozódott volna a koronavírussal kapcsolatos kilátásokról. Worst of: Dél-Koreában csak maszkok kellettek a helyzet kezeléséhez, úgyhogy nálunk is elég lesz ennyi
  • Így néz ki a kapcsolatkövető munka Törökországban. Mobil csapatok, kimennek, tesztelnek, kérdeznek, telefonon is kapcsolatba lépnek, eleve kész pandémiás tervet követnek.
  • Olaszországi excess mortality. "More than 90,000 people died from February 20 to Mar 31, a 38.7% increase from the average of approximately 65,000 during the same period, from 2015 to 2019." Ez 25 ezerrel több a 2015-2019-es azonos időszaki átlagnál. Korábban 3402 extra halálesettel számoltan, nagyrészt északi adatok konzervatív számítása nyomán. Ha a 25 ezer felét figyelembe veszem, akkor ez 9098, megint csak konzervatívan. G.a.h. így +50135. 
  • És akkor még jön hozzá ez. Maszkviselés miatt figyelmeztetett leány apja lőtte fejbe a lányát figyelmeztető biztonsági őrt. Genesee County, Michigan. (+50136.)
  • Isztambulban március-áprilisra +3377 haláleset az ötévi átlaghoz képest. Korábban 1100-ból 550-et vettem figyelembe egy egyhónapos időszakra március 9.-április 12. időkeretben. A különbözet felét számolva 1688-550=1138. G.a.h.: +51274.
  • COVID-19-es fertőzés (vagy antitest) kimutatása nyomán megfigyelt Kawasaki (pl. az artériás érfalak gyulladásával) gyerekeknél, ezúttal az Egyesült Államokból jelentett esetek kapcsán.
  • A SARS-CoV-2 S-fehérjéjének elemeit felismerő monoklonális antitestekkel kapcsolatos kutatások is figyelmet érdemelnek. A link mentén egy in vitro működő monoklonális antitestről van szó, egér eredetű hibridóma sejtekből előállítva, ahol a SARS-1-es és 2-es stimulációhoz VSV-vírust használtak vektornak.
  • Az ACEI/ARB-kezelésekről egy kis mini-metaanalízis Dr. Roger Seheulttől. Három nagyobb tanulmány alapján nem asszociálódnak rosszabb kimenetekkel, sőt az ACEI-k és a koleszteringyógyszerek közül a sztatinok éppenséggel alacsonyabb kórházi halálozáshoz vezettek. Büszke vagyok egy kicsit magamra is, mert pár napja felvetettem itt, hogy az LDL-koleszterint is nézni kellene a betegeknél, ha egyszer az erek elzáródásának a lehetősége itt erősen fennáll.

A nap zárásaként — dolgoztam egy ilyen ábrán a SARS-CoV-2 mechanizmusairól a véredényekben és azokhoz közvetlenül kapcsolódóan. Mivel egyelőre nem bizonyított (csak számítógépen modellezett), a vírus lehetséges interakcióját a porfirinnel a vörösvértestekben kihagytam.

sars-cov-2_inbloodvessels_2.jpg

A fenti ábrát egyébként már újabb dolgokkal kell bonyolítani. De ezt majd holnap... Egyszerűen hihetetlen ez a vírus.

2020.05.07.

Itt jön, amit tegnap már nem bírtam leírni. Szóval vannak a foszfolipidek. Nagyon fontosak, mert "amfifilikus" molekulák, egy hidrofil (vízkedvelő) foszforsav-fejjel, és két hidrofób zsírsav-farokvéggel. Vizes közegben ezért kiváló kettős réteggé állnak össze, a hidrofil fejekkel kifelé. Úgyhogy a sejtmembrán fontos elemei. Ha valakinek antitestjei vannak foszfolipidek ellen, az elég kellemetlen lehet. A népesség 1-5%-ának vannak antifoszfolipid antitestjei (aPL Ab), de gondot ez még nem feltétlenül okoz — az antifoszfolipid szindrómához (APS) ezekre nagyobb mennyiségben és tartósabban van szükség, és ez már csak 5/100000/év prevalenciával fordul elő. Életveszélyes vérrögképződéssel jár. Még ritkábban lehet belőle nagyon csúnya CAPS, azaz Catastrophic Antiphospholipid (Antibody) Syndrome, többszervi elégtelenséggel, a minden eltömítő vérrögök miatt. 

Hogy jön ez a képbe? COVID-19-es betegeknél mértek már jelentős aPL Ab mennyiséget. Mike Hansen dokinak ebben a videóban erről az jut az eszébe, hogy mivel éppen az APS esetében fordul elő egyébként az, hogy egy páciensnél vénásan ÉS artériásan is előfordulnak trombotikus események, talán éppen ez az egyik alapvető mechanizmusa a COVID-19-nél megfigyelt atipikus DIC-nek (ereken belüli véralvadásnak), amit a szakirodalomban pár forrás már CAC-nak, azaz COVID-Associated Coagulopathynek nevez. Egy három páciens esetét feldolgozó kínai tanulmány a diskurzus kiiunduló pontja: Zhang et al. Coagulopathy and anti-phospholipid antibodies in patients with COVID-19. NEJM DOI: 10.1056/NEJMc2007575 (non-peer reviewed correspondence). Mások nem feltétlenül értenek ezzel egyet. "It is well described that aPL Ab can arise transiently at times of acute infection, inflammation, or thrombosis", írják, vagyis az aPL Ab emelkedését ideiglenesnek és inkább következménynek, mint oknak látják. Ezzel együtt ez plusz egy veszélyes mechanizmus lehet, amit a SARS-CoV-2-fertőzés beindít.

Nekem még egy dolog jutott eszembe a fentieken kívül: a Guillain-Barré előfordulása 6-40/1000000/év, az APS-é, mint említettem, 5/100000/év, a Kawasakié Japánon kívül 8-67/100000/év 5 év alattiaknál. Ritka autoimmun rendellenesség mind, és a COVID-19-nél már előfordultak, legalább látszólag a fertőzéshez kapcsolódóan. Ebben látom egy összefüggés lehetőségét. Immunológiailag naiv populáció találkozik tömegesen újonnan felbukkanó és viszonylag virulens kórokozóval: benne van a pakliban, hogy az immunrendszer esetenként kicsit megőrül + statisztikailag kevésbé valószínű találkozásokra is van esély ilyen esetszámok mellett.

Dr. Seheult eközben a vérrögképződés hátteréről szolgál további adalékokkal. Az 1964-ben felfedezett Weibel-Palade-testekre irányítja a figyelmet, ahonnét az entotheliális sejtek problémái kapcsán exocitózissal felszabadul a hemosztázisban szerepet játszó von Willebrand faktor (vWF). A vWF, mellesleg, épp a nullás vércsoportúaknál jellemzően alacsonyabb szinten van jelen, és pont nekik van némi túlélési előnyük nem-peer-reviewed klinikai tapasztalatok szerint (az A-sokkal szemben, akiknek túlélési hátrányuk van). A vWF statikus állapotban globuláris alakú, de a véráramban megnyúlik, és lánccá kapcsolódik össze, multimerikusan — ezt a láncot az ADAMTS13 enzim vágja fel praktikus hosszúságú darabokra (a 0 vércsoportúaknál ez a proteolízises vagdosás gyorsabban megy végbe, ami így dupla előny számukra). Terápiás szempontból nem jelentéktelen, hogy az ADAMTS13-hoz kell cink... ami tehát többféleképpen is hasznosulhat COVID-19-terápiában. Én annyit tennék ehhez hozzá, hogy a Weibel-Palade-testek a P-szelektin nevű fehérjét is tárolják, amely erek sérülésénél leukocitáknak jelez, és ezeket "odainvitálja". Például a neutrofileket... hogy még jobban összeálljon az a bizonyos fenti kép, amit ezek után kifejezetten leegyszerűsítőnek is mondhatunk.

  • Más. Az európai politikában közben a német Alkotmánybíróság egy döntése kavar nagy viharokat. A döntés valójában 2015-től kezdődően a koronavírus-válság előttig bezárólag zajlott, az eurozóna stabilizálására irányult kötvényvásárlásokra vonatkozik, a német központi bank által — ezeket minősítette a német alkotmányt sértőnek, nem a válságintézkedéseket, de Pistikéék a homokozóban már csinálják a műbalhét, hogy ezzel akkor összeomlik Európa (mert szeretnének pár homokvár összerugdosásához felhatalmazást ezzel).
  • Itt van ez a metaanalízis az Infection Fatality Rate-ről (halálesetek / teljes, részben becslésen alapuló esetszám), ami tehát szükségszerűen alacsonyabb a Case Fatality Rate-nél (halálesetek / klinikailag manifesztálódó esetek). A kihozott érték 0,75%. Már várom, hogy fogalmatlan emberek miket hoznak majd ki ebből. Hiszen ez "csak" a hét és félszerese annak az értéknek, amit a szezonális influenza valójában soha nem ért el. Érdemes lehet rámutatni, hogy (1) a hét és félszeres az annyival több emberi lény; (2) valójában sokkal többször annyi emberi lény, mivel a szezonális influenza IFR-je soha nem volt 0,1% ténylegesen; (3) ez egy immunológiailag naiv populációban terjedő, tehát exponenciálisan növekedni képes járvány, végeredményben az IFR-től függetlenül is sokszorosan nagyobb összes halálozással; (4) ez egy újabb fertőző betegség, tehát a hozzá kapcsolódó mortalitás hozzáadódik az egyéb mortalitáshoz; (5) az egyébként változékony tényleges IFR önmagában vajmi keveset mesél arról, mi történik az érintett egészségügyi rendszerekkel, és pl. milyen addicionális halálozás adódik emiatt; (6) az "esetek" immunitását a jövőre nézve semmi nem garantálja jelen állás szerint; egy részük immunis lesz, egy részük talán nem; aki immunis lesz, az pedig nem lesz immunis örökre. Remélem, holnaptól minden újságíró és Facebook-tudós ezen alapvető tények birtokában kommentálja majd a dolgokat... Remélem, de persze nem erre számítok.
  • Fentebb már utaltam rá, hogy a francia retrospektív PCR-tesztelés erősen megbízhatatlannak tűnik. Ellőttek egy tesztet, és jó eséllyel csak kaptak egy fals pozitívat, ez volt az első gondolatom. Itt a teszteredményről egy kis kritika, meg lehet nézni. By the way: érdekes látni, hogy egy csomó sajtócikk szól most egyetlen erősen kétséges, december 27-i eset alapján arról, hogy "a vírus decemberben már keringett Európában", miközben március elejéig minden felbukkant eset kapcsán az ment, hogy "relax, nincs itt helybeni terjedés". A francia kutatókkal kapcsolatban pedig: van ugyebár antitest-vizsgálat. A tanulmányukban egy szó nem esik arról, hogy az érintetteknél ezt elvégezték volna, pedig egy negatív antitest-teszt elgondolkodtató lehet adott esetben. 

2020.05.08.

  • Elejtett mondat egy amúgy is érdekes cikkben, Magyarországról: "A tesztek elvégzésére egyszerűen nincs elegendő kapacitás. A négy orvosi egyetem éppen most kezdi monstre szűrőprogramját, 17 ezer alany bevonásával, ezzel is radikálisan szűkítve a hozzáférés lehetőségét." Lehet, hogy a szűrőprogramnak nem most lenne itt az ideje?
  • A szlovéneknél is lenyomtak egy "reprezentatív(nak szánt) antitest-vizsgálatot", és bár magyarázzák, hogy milyen jól kezelték a mintavételi problémákat, ezzel elfedik a lényeget, a jóval nagyobb módszertani problémát. Szlovénia népessége 2 millió fő felett. Van 1449 fertőzöttjük kimutatva, 99 halott mellett (6,83% a haláleset). Ezek azok a számok, amelyek mellett komolyan vehetetlen a "reprezentatív antitest-vizsgálat". Az átfertőzöttség ismert szintje így ugyanis 0,07245%, és így a valódi szint sem lehet olyan magas (még ha az ismert szint sokszorosát feltételezzük is), hogy a tesztekkel adott szenzitivitási és specificitási problémák miatt ne legyen a fals pozitívak aránya brutális. És akkor még nem beszéltünk az olyan fals pozitívokról, amelyek nem szó szerint falsak, csak keresztreagálás eredményei a már korábban elterjedt humán koronavírusokra meglévő antitestekkel. 
  • A járványtörténelmi revizionizmus újabb állomásaként a tavaly októberi vuhani katonai játékok résztvevőitől jelenti pár sajtócikk kijelentő módban, hogy ők már koronavírusosak voltak, mivel betegek voltak (miközben az érintettek ennél óvatosabban fogalmaznak). Antitest-vizsgálatot nekik, és még abból is, azután is felelős következtetést kérnénk (vagyis IgG megléte esetén hangsúlyozni, hogy az származhat a vizsgálat napjától akkár 28 nappal korábbról is).
  • Hogy érthető legyen, honnét jön a Vuhani Katonai Játékokkal kapcsolatos őrület: ennek az amerikai bicikliversenyzőnek a történetéből. Miután fellökték biciklivel, és hatalmasat esett, azt nyilatkozta: "I just had to catch my breath, but it wouldn't come." Egy George Webb nevű ismert for-profit konteóvállalkozó fújt ebből hantalázat, méghozzá (naná) egy "névtelen forrásra" hivatkozva, akit "nem fedhet fel". Ezt kapta fel aztán a Kínai Kommunista Párt, akik ez úton is köszönik a lelkes, utólagos európai támogatást ezzel kapcsolatban. A világ megőrült. Más paradigmába ezt nem tudom rendezni.
  • Interjú Duda Ernő virológussal. Hasznos részletek: (1) "Januártól már hallani lehetett anekdotákat nyugatról hazatérő magyarokról, akik januárban-februárban tüdőgyulladás tüneteit mutatták, de egy antibiotikumkúra felírásán kívül nem szenteltek nekik több figyelmet". True that. Kieg.: lásd ezt a cikket is. (2) "El tudja ön képzelni, hogy ha most Nógrád megyében egy cigánytelepen meghal valaki tüdőgyulladással, akkor letesztelik őt koronavírusra? Én majdnem biztos vagyok benne, hogy nem." In your face. (3) "a két hónap (kijárási korlátozás) kellett ahhoz, hogy az emberek megtanulják, hogyan lehet kevésbé fertőző módon élni. Nyilván ez nem vonatkozik mindenkire, Magyarország tele van macsó emberekkel, akiket sem a cigi, sem az alkohol vagy a gyorshajtás nem tud elpusztítani, ők nem fognak szájmaszkot viselni, és ha megfertőződnek, továbbadják azt." Livin' on the edge / You can't help yourself from fallin' (Aerosmith). (4) "Február elején már tudni lehetett, hogy ezt a járványt nem lehet Kínában tartani. Napok alatt el lehetett volna kezdeni a tesztek gyártását, darabonként rendkívül olcsón, 2-3 ezer forintért munkabérrel együtt." Who saw that coming? We did. (5) A PCR-tesztekhez történt kezdeti mintavételekről: "Ennél a vírusnál viszont bizony rendesen meg kell dörzsölni a dolgot, akkor fog lejönni annyi nyálkahártya-sejt, amiből már ki lehet mutatni a vírust. Ezt viszont nem tanították meg a mintavevő orvosoknak, így sok, súlyosan beteg embernek lett negatív a koronavírus tesztje." And the rest is history.
  • Manaus, Amazonas-régió, Brazília, szezonális átlagos meghaladó halálozás temetések számában mérve. "City data shows that 2,435 people were buried in April alone, compared with 871 burials during the same month a year ago." A különbözet felével, konzervatívan a g.a.h.: +51274+782=52056.
  • Kezdek utánamenni az interferonoknak, ennek a cikknek a nyomán, mely az interferonok által serkentett ACE2-kifejeződés miatt az éppen a fertőzésből következően, a védekezésben szerepet játszó interferonok révén végbemenő fertőzésfokozódás lehetőségét vetette fel. (Az ACE2 egyenesen a jackpot egy vírus szempontjából.) 
  • Itt egy cikk 2016-ból, egerek tanulmányozása alapján, a korábbi SARS-vírusról. Az érdekes az, hogy fertőzésfokozás helyett az első probléma az Type I interferon (INF-I) interferonválasszal (a "veleszületett"/innate immunrendszer részeként), hogy nem jelentkezik, késlekedik, miközben a vírusreplikáció sikeres, és egy nap után csúcsszintet érhet el az érintett tüdősejtekben. A SARS-vírus ügyesen elkerülte, hogy a jelenléte a patogénekhez köthető molekuláris mintázatok (PAMPs, Pathogen-Associated Molecular Patterns) révén felismerhető váljon a rezidens makrofágok (többek között légzsáki és szövetközi makrofágok a tüdőben), dendritikus sejtek (kórokozóktól és egyéb, kívülről bekerült anyagokból származó antigéneket prezentálnak az adaptív immunválasz résztvevői felé pl. a bőrben és egyéb, a külvilággal kontaktba kerülő felületeken, így pl. a belekben is), hisztiociták, Kupffer-sejtek (a májban) PRR-receptorai által (Pattern Recognition Receptors), melyek a sejtek károsodásának érzékelői is (Damage-Associated Molecular Patterns, DAMPs). Nagyon fontosak a különféle fontos szöveteket kolonizáló rezidens makrofágok például. PRR-ek vannak az említett sentinel (gyakorlatilag "helyőrségi") sejteken belül és e sejtek felszínén is — vírusok kapcsán az előbbiek az érdekesek. A SARS-vírus át tudta verni őket sok betegnél, vagyis ilyenkor gyakorlatilag kicselezte a sejt védelmi elemzőit. Itt egy rövid előadás a témában. Ez pedig egy még jobb, a TLR-ekről ("tollszerű receptorok"). Endoszómákban a TLR7 és TLR8-as receptorok hivatottak felismerni a sejtbe bekerült egyszálú RNS-vírus jelenlétét (amilyen a SARS-CoV-2). A citoplazmán belül, a citoszolban pedig a RIG-I receptorok játszanak ilyen szerepet. Itt egy jó áttekintő tanulmány is a témában. A TLR7 és TLR8 az endoplazmatikus retikulumban, a lizoszómákban és endolizoszómákban is előfordulnak. Van kötő- és jeladó-doménjük. Ha bejeleznek, soklépcsős folyamatot indítanak el. És így tovább. Nyilván sokkal tovább bonyolítható ez. (Kieg.: itt egy érdekes tanulmány, in silico (azaz számítógépes modellezéssel) a rezidens tüdőszöveti leukociták szintjének jelentőségéről a kezdeti SARS-CoV-2-immunválaszban.)

Hogy legyen jó hír is itt — így állnak most a helyzetet jól kezelő országokban (persze kontrasztnak más példa is ott van; az ábra új esetek tíznapos mozgó átlagának változását mutatja):

gorbek.jpg

  • A svéd epidemiológia géniusza, Anders Tegnell eközben: "The death toll really came as a surprise to us."
  • Eközben Magyarországon: a Népegészségügyi Központ oldalán úgy módosítottak néhány érdekes adatot, mintha nem lenne se tegnap, se holnap. Az eredeti adatok szerint 2855 influenzatesztelésre küldött mintából 30 volt pozitív a 12. naptári héten, márciusban. Ugyanekkor a sentinel/őrszem szerepre kijelölt háziorvosoktól bejött 26 mintából 12 volt pozitív (abból 8 influenza A, azon belül 4 H1N1-es). Amit nem sentinel háziorvosok küldtek, azt kórházak vagy nem-sentinel háziorvosok küldték be... Élő Anita kiváló nyomozásának az eredménye. A minták amúgy nem feltétlenül voltak mind koronavírusosak, de közülük jó pár azért szinte biztosan. Mellettük viszont értelemszerűen más kórokozó-gyanúsítottak is felvetődhetnek.

2020.05.09.

  • A koronavírus-dömping miatt sok minden relatíve feledésbe merülhet, a jemeni éhezéstől a kanyaróoltásokon át a maláriaprogramokig.
  • Kutatási eredmények arról, hogy a New York-i SARS-CoV-2-variáns terjedt szét jobban az Egyesült Államokban. Még Alaszkában is.
  • Kawasaki-témában érdekes látni, hogy Dr. Seheult is arra jut, amire én két napja: hogy alapvetően arról van szó, hogy a vírusfertőzés kiváltotta immunválasz rendellenességei fordulnak elő COVID-19-nél (is). A Kawasakinál az itt tárgyaltak szerint előfordul, hogy a vaszkulitiszként (erek gyulladása) induló állapot az ereken kívüli szöveteket is érinti, és monociták, makrofágok, limfociták hatolnak be oda is — mindez COVID-19-nél is megeshet.
  • Elém került Shi Zhengliék egyik 2010-es cikke. Különféle denevérfajok eltérő ACE2-es receptorainak esetében különböző fogékonyságot találtak a SARS-CoV vírussal való fertőzhetőségre. Már ez önmagában is nagyon jelentős, mert ez a review előtti cikk pl. embereknél is jelentős különbséget talált ebben a tekintetben az ACE2-es receptor eltérései alapján, már a SARS-CoV-2 vírus esetében.
  • De még egy kicsit Shi Zhengliéknél maradva... Ezt csinálták pl.: "we extended our previous study to ACE2 molecules from seven additional bat species and tested their interactions with human SARS-CoV spike protein using both HIV-based pseudotype and live SARS-CoV infection assays." Itt egy "kicsit" meglepődtem. Szóval vették a HIV-vírust, és összekombinálták a SARS-CoV S-fehérjéjével. Én ezt saját, egyéni szaknyelvemen WTAF-eljárásnak nevezem. What. The. Actual. Fuck. Az ilyesmit rekombináns VSV-vel szokás csinálni...
  • Pikáns vonatkozása az imént említett dolognak, hogy még január elején kikerült ez az azóta visszavont indiai tanulmány, ahol szerepelt pl. ez az állítás: "We found 4 insertions in the spike glycoprotein (S) which are unique to the 2019-nCoV and are not present in other coronaviruses. Importantly, amino acid residues in all the 4 inserts have identity or similarity to those in the HIV1 gp120 or HIV-1 Gag. Interestingly, despite the inserts being discontinuous on the primary amino acid sequence, 3D-modelling of the 2019-nCoV suggests that they converge to constitute the receptor binding site." Az érvelésben külön kifejtették, hogy "one may sporadically expect a fortuitous match for a stretch of 6-12 contiguous amino acid residues in an unrelated protein. However, it is unlikely that all 4 inserts in the 2019-nCoV spike glycoprotein fortuitously match with 2 key structural proteins of an unrelated virus (HIV-1)." Az "insertion" (beszúródás) szót itt úgy kell értelmezni a kontextusból adódóan, hogy az eredeti (2002-2003-as) SARS-CoV-hoz képest új szakaszokról van szó (amellyel ugyanakkor nagyon sok egyezés fennáll, értelemszerűen). Sok releváns kritika megjelent azóta erről a bombasztikusan ható tanulmányról, lásd például itt, ahol szerepel az ellen-állítás, miszerint az indiai kutatók által HIV-1-re és SARS-CoV-2-re specifikusnak nevezett aminosav-szekvenciák valójában előfordulnak más denevér-koronavírusoknál is. Egy kommentelő a biorxiv.org oldalon, ahol a review előtti indiai tanulmány megjelent, azt is szóvá teszi, hogy a HIV-1-es proteinjei felülreprezentáltak az NCBI adatbázisban, és így könnyebb ilyen grandiózusnak tűnő "egybeesésekbe" beleszaladni velük kapcsolatban.

2020.05.10.

  • Egy (talán éppen magyar származású) amerikai virológus, Judy Mikovits terjeszt elképesztő dolgokat a járványról, például, hogy nincs vakcina egyetlen RNS-vírus ellen sem (virológus létére nagyon fura, hogy legalább a mezei influenzaoltás nem jut az eszébe). Vagy hogy „az arcmaszk aktiválja a vírus kifejeződését”. És hasonló nettó baromságokat. A hölgy korábban is nagy botrányokat kavart már a „munkásságával”. Pl. benne volt egy később visszavont tanulmányban, mely az XMRV egér-retrovírust okolta a krónikus fáradtság szindrómáért, és nem kis félelemhullámot indított el ezzel.
  • Kicsit ijesztő beszámoló egy másik virológustól, Peter Piottól a betegségről, miután maga is átesett rajta, 71 évesen. Idézem: „Many people think COVID-19 kills 1% of patients, and the rest get away with some flulike symptoms. But the story gets more complicated. Many people will be left with chronic kidney and heart problems. Even their neural system is disrupted. There will be hundreds of thousands of people worldwide, possibly more, who will need treatments such as renal dialysis for the rest of their lives.”
  • Svájci tanulmány a nem-gyógyászati intervenciós intézkedések + a svájciak magatartás-változásának hatásáról az R0 leszorításában 1 alá valamennyi kantonban.

2020.05.11.

  • Nagyon fontas paper arról, miért fontos a járvány felszámolására (nem csak szinten tartására) törekedve csinálni a korlátozó intézkedéseket (és belefektetni a plusz munkát a tesztelésbe-kapcsolatkövetésbe). Exponenciális hanyatlás is elérhető ugyanis. A lényeg tulajdonképpen ez a képlet: Rc = R0 (1 - Cp)2, ahol a hatványozódás abból adódik, hogy a potenciális transzmisszió két végpontján egyaránt jelentkezik kockázatot csökkentő hatás.
  • Új vuhani eset. Antitest-vizsgálatot a lakótömb összes lakójának, és ha abból nem jön ki válasz, akkor jöhetnek a környéken élő macskák és rágcsálók is.
  • Ez a könyv érdekes lehet, pláne olyan viágba előretekintve, ahol a szuverenitásmánia várhatóan nőni fog.
  • Epikurosz beküldése ez is: az RT-LAMP eljárás a vírus-RNS kimutatására. Diagnosztizáláshoz most már elég sokféle módszer kezd rendelkezésre állni. Lehet korroborálni (párhuzamosan használni ezeket falsok kiszűrése végett), lehet költséget csökkenteni, és lehet a tesztelést nagyságrendileg növelni.
  • Előrejelzés Olaszországra. Ha a lazításokkal a lockdown előtti szint 20%-ára tér csak vissza a mobilitás, már az is (hetekkel később) brutál hatáshoz vezethet halálozások tekintetében. Húsz szálék az nagyon optimista, ennél a mobilitás gyorsabban visszatérhet egy magas szintre. A szerzők mégis pesszimistának mondják magukat, mert lesz több tesztelés és kapcsolatkövetés, gondolják. Találós kérdés: ha Lombardiában, az ottani attack rate, azaz megbetegedési arány mellett ez várható, akkor... Magyarországon vajon mi?
  • Ezzel együtt közben a kórház-kiürítéses intézkedéseket értelmetlennek nyilváníthatjuk. Rendelkeztek ugyanis arról, hogy a koronavírusos betegeket Budapestre kell szállítani. Akkor minek a vidéki kapacitásfelszabadítás? Oké, hogy egy nagy járványnál majd jól jöhet, de az hetekre lehet.
  • Világ tobzoskái, közeledik az igazság órája. Kieg.: vagy mégsem? Itt van egy másik csapat tanulmánya, és ők ezt írják: " It is striking that two related lineages of CoVs are found in 123 pangolins and that both are also related to 2019-nCoV. This suggests that these animals may 124 be long-term reservoir hosts for these viruses, which is surprising as pangolins are solitary animals with relatively small population sizes, reflecting their endangered status". (Kiemelés tőlem.) Kieg.: utánanéztem, mekkora a relatíve kicsi populáció. A válasz az, egyfelől, hogy nem olyan kicsi. Itt említik, hogy 2019 áprilisában szingapúri vizeken sikerült elfogni Nigériából érkező tobzoskapikkely-szállítmányt kb. 72 ezer lemészárolt tobzoskától származó mennyiségben. A szállítmány nyilvánvalóan Kínába vagy kínai megrendelők részére indulhatott, mivel a kínai gyógyászat a pikkelyekből készült őrleményt természetesen "hasznosítja" (legalább a kereskedő számára van belőle haszon). Egy másik forrás szerint évente kb. 20 tonnányi tobzoskapikkelyt csempésznek, de ez durva alábecslésnek tűnik, mert 2017-ben pl. volt egy 11,9 tonnás fogás Shenzhenben novemberben és egy 23 tonnás valahol Kínában decemberben. Az utóbbi években tehát minden bizonnyal erősen 20 tonna fölé növekedett a kínai importkereslet, és a legtöbb forrás meg is jegyzi, hogy a kínai, fülöp-szigeteki és délkelet-ázsiai tobzoskapopulációkból alig maradt mára — a kereskedőknek nyilván más források után kellett nézniük, amihez jól jön az erősödő kínai jelenlét is Nyugat-Afrikában. 
  • Járvány a Fehér Házban? Ha nagyon ráérek majd, írok egy ponyvát ezzel a címmel.
  • Humán koronavírusról először készített felvételeket (1966-ban): June Almeida (portré). Élenjáró volt a negatív kontrasztosításos és később az immun-elekronmikroszkópos vizsgálatok terén. 
  • Körülnéztem kicsit, hogy Kínából milyen antitest-vizsgálatos eredmények vannak. Ahol nem a járvány felszámolása előtt szórakoztatják az embereket ezekkel. "For instance, a study at Zhongnan Hospital in Wuhan, China, found that 2 per cent of 3600 staff there had antibodies to the virus. That is surprisingly low, given the scale of the outbreak in Wuhan and that hospital staff are probably more likely to get infected than the general population." Ebből én már nem kevesebbet látok szükségesnek kimondani, mint hogy rengeteg ilyen kutatás a nyugati országokban egészen egyszerűen felelőtlen kockáztatása az emberéleteknek effektíve valamilyen más érdek szolgálatában.
  • Dél-Koreában is indult egy új kitörés. Amit a dél-koreaiak eddig nem csináltak: a mostani kitörés miatt leállították az Itaewon szórakozónegyed bulizós helyeit. A "Hammer and the Dance" c. sláger még sokáig ranglistás lesz, a "Dance" pedig nagyon hosszan elnyúlhat.

2020.05.12.

Egy érdekes cikk. Alább több pontban a tartalmából:

  1. A névtelen szerző többek között a ZC45 és a ZXC21 koronavírusok közötti természetes eltérést mutatja előbb a szinoním/nem-szinoním (csendes/nem-csendes; kódolt aminosav-szekvenciát meg-nem-változtató/azt megváltoztató) pontmutációk természetes arányossága (5:1) alapján — majd ugyanennek a természetes arányosságnak a szabályszerűen eloszló meglétét hiányolja a SARS-CoV-2, illetve a járvány kezdete után annak lehetséges, 96,2%-ig azonos genommal rendelkező elődjeként leírt RaTG13 denevér-koronavírus között. Adalékul ehhez a tézishez: itt publikálta egy nagyrészt kínai csapat a ZC45-ös és ZXC21-es vírusokat mint leletet, 2018-ban (Zhejiang tartományből sikerült begyűjteni ezeket Shi Zhengli, a híres kínai denevérvírus-kutató pedig itt publikálta az RaTG13-ról említetteket, idén február 3-án megjelent cikkben. 
  2. A SARS-CoV-2 pontmutációkat "tűrő", azaz a vírus számára evolúciós hátránnyal nem feltétlenül járó módon változékony E-fehérjéjében (E=envelope) a ZC45 és a ZXC21 vonatkozó aminosav-szekvenciáival fennálló teljes azonosságról közöl adatot a járvány elejéről (miközben az utóbbiak 2018-ban lettek feltöltve). És ehhez képest találja furcsának, hogy két hónappal később, azaz idén áprilisra már látszanak mutációk a SARS-CoV-2 E-fehérjéjében a ZC45-höz és a ZXC21-hez képest. (Kieg.: az E-fehérjének is van kritikus kötődoménje azért (PBM), szóval ennek a variálhatósága sem korlátlan egyébként.)
  3. Ahová nem tudok a cikk szerzőjével tartani: szalad levonni a következtetést, hogy ez egy biológiaifegyver-programra utal a SARS-CoV-2 eredeteként. Az csak az emberi hülyeséggel együtt lenne lehetséges (a SARS-CoV-2 messze nem optimális biológiai fegyver ugyanis, mivelhogy bumerángként működik, azaz kéretlenül hazagyün). Persze az emberi hülyeséget nem lehet kizárni soha. De első körben a látottak lehetnek pl. jó szándékú kutatás, akár ilyen jellegű gain-of-function kutatás eredményei is. (Persze legelőször is jó lenne, ha egy virológus is ránézne minderre. Az forráskezelési szempontból nem jó jel (soha nem jó jel), hogy az idézett cikk szerzője névtelen, háttere pedig így bizonytalan — és az itt tárgyalt cikkel ez a helyzet.)
  4. Kieg.: egyéb források közben ezt vették észre a kínai denevérvírus-adatbázisban. Az amerikai NCBI-adatbázisba idén, 2020. március 24-én feltöltött (és még január 27-én, a fentebb említett februári journal-publikációhoz benyújtott) RaTG13-ast azonosként említik a még 2016-ban csak részleges információval feltöltött, és jóval korábban, 2013 nyarán denevérektől begyűjtött BtCOV/4991 vírussal, amelynek a replikációhoz szükséges, az RNS-dependens RNS-polimerázt kódoló részét osztották csak meg anno. Ellenőriztem a dolgot: még fent van a kérdéses rekord a kínai adatbázisban. (Jut eszembe, a thread elején idézett cikk utalt is rá, hogy az RaTG13 2013-ból származik — ezek szerint így tudhatta ezt a szerző.)
  5. Kieg.: korábban erre nem nagyon figyeltem, de a fentiek fényében igen érdekes, hogy a 2013-as RaTG13 és a 2019-ben felbukkant SARS-CoV-2 egyik alapvető különbsége (a magas egyezés mellett is) egy furin hasítási hely hiánya az előbbi esetében. Erre mondják lazán virológusok, hogy "á, hát az biztosan bele-rekombinálódott valamilyen más vírussal való találkozáskor". Ezzel együtt, még az előző előtti mondatban linkelt konzervatív elemzés is arra jut, hipotetikusan, hogy "Acquisition of the furin cleavage site might be viewed as a ‘gain of function’ that enabled a bat CoV to jump into humans and begin its current epidemic spread." A vírusok és a sejtek membránja közötti fúzió komplikált folyamatáról érdemes megnézni az alábbi videót, hogy egy ilyen hasítási hely szerepét értékelni tudjuk. A vírus szempontjából itt nem babra megy a játék. Ha valami ott rossz helyen lenne, irány az evolúciós temető. 
  6. Kieg.: a furin hasítási hely jelentőségéről további adalékok itt, kiemelések tőlem: "Furin is a protease ubiquitously expressed in a variety of organs and tissues, including brain, lung, gastrointestinal tract, liver, pancreas and reproductive tissues. With the furin cleavage site on the S protein, 2019-nCoV probably gains ability to infect organs or tissues insensitive to other coronaviruses, leading to systematic infection of 2019-nCoV in the body. Even worse, the wide distribution of 2019-nCoV in a patient body may release the virus into the environment via more diverse ways, severely enhancing the transmission of 2019-nCoV." Hát, ez azért eléggé jelentőskének tűnik.

Más.

  • Az afrikai sertéspestis-vírus (ASFV) a sertésállományt pusztítja pl. Indiában.
  • Ez az ábra (a Financial Timesból) elég jól mutatja (logaritmikus jelleggel), hogy Oroszország és Brazília állnak különösen rosszul jelenleg. Azért közben Mexikóról és Indiáról is érdemes megemlékezni persze.

2020.05.13.

  • A Koronavirus.gov.hu-n (2020.05.13.) ma szereplő adatok alapján az esethalálozási arány a lezárt esetek körében vidéken 16,18%-os, a fővárosban 34,83%-os. Szignifikanciatesztekkel inkább nem is fáradnék, jelentős különbség ez. Faktorok: légszennyezés? Az esetek kor szerinti megoszlása? Nozokomiális fertőzések fővárosi koncentrációja?
  • Az acetilcisztein hasznosságáról (Dr. Seheult). Sőt, hasznosságairól, többes számban. Diszulfid kötések elvágása a tüdőnyáktól a von Willebrand-faktor-láncolatokig.
  • Arról, hogyan oldják az utazási korlátozásokat Ázsiában, pl. Kínában. Tesztelés nélkül nem tennék, ez fontos tanulság lehet. Tesztelni legelőször is a saját lakosság egészsége érdekében fontos, de később a behurcolások megelőzése is fontos szempont lesz. Most azt az aspektust inkább nem kommentálnám, hogy az üzletember-utazások jelentik láthatóan a prioritást.
  • A Washington állambeli kórusklaszterről részletesen, a CDC-től. Összesen 89,7%-os megbetegedési arányt énekeltek össze.
  • Angliában egy szociopata embert ölt fertőzöttként azzal, hogy leköpött egy kalauzt, és rá is köhögött. Jogilag ez nyilván értelmezhetetlen, de erre mondanám, hogy 50%-ig szándékos veszélyeztetés, 40%-ban gyilkosság, 10%-ban terrorizmus.
  • Szezonális átlagot meghaladó halálozás Latin-Amerikában, adatok. Mindenhol a különbözet felét veszem figyelembe. Lima, Peru: 1550; Manaus, Brazília (itt a múltkor temetések alapján (2435-871)/2 volt, most regisztrált halálesetek alapján (2800-1000)/2-re módosul, az 1000 ebből konzervatív számítási taktika; így akkor: +964-782=+182. G.a.h.: 52056+1732+n=53788+n. Egyéb súlyos részletek is a cikkben, pl. a manausi őshonos törzsbeli férfi esete, akinek a közösség próbálta összedobni a pénzt taxira, de mire sikerült, ő meghalt.
  • Wuhan, második forduló.
  • Dmitrij Peszkov orosz elnöki szóvívő kórházban. Olga Ljubimova kulturális miniszter is fertőzött.
  • Intenzív osztályi tűzben, mely a lélegeztetőgépek csúcsra járatása miatt keletkezett alapvetően, öt koronavírusos beteg halt meg Pétervárott. G.a.h.: 53793+n.
  • Az Itaewon-klaszter Dél-Koreában. A koreaiaktól megszokott villámgyors kapcsolatkövető elemzést ezúttal az lassította, hogy az érintett szórakozóhelyek jelentős LGBT-közönséget szolgálnak ki, és itt ezért, az anonimitás érdekében hamisították a vendégkörről gyűjtött adatokat. Anno a Shincheonji egyházat kényszerítették a tagsági információk kiadására; most rugalmasabb válasz született, és elérhetővé válik az anonim tesztelés. Kieg.: itt ez a cikk is, egy "epic pub crawl" lehet a klaszter kialakulásának forrása, egy 29 éves férfi szuperterjesztővel.

2020.05.14.

  • A legionáriusbetegség probléma lehet a home office után újra használatba vett épületekben, ahol előtte pangás volt, a vezetékekben álló vizekkel, ahol a Legionella baktérium tenyészhet.
  • A vérrögök problémájáról. Kép a most már jellegzetesnek mondható "COVID toes" jelenségről indításnak, aztán holland adatok, miszerint 184 páciensből 31%-nál következtek be trombotikus események.
  • Tanulmány a Lancetben, UNICEF-es háttérrel. Optimista projekciója, hogy az aktuális eü. válság miatt 253500 főnyi addicionális gyermekhalálozásra és 12200 anya addicionális elhalálozására lehet számítani globálisan.
  • Adatok az esethalálozás kor szerinti megoszlásáról hat országban. 49 éves korig nem túl nagy a szórás, utána viszont 50-59 év között 0,2-től 2%-ig terjed (utóbbi az arány az olaszoknál és a svédeknél ebben a korcsoportban). 60-69: 1,1-től 7,1%-ig; 70-79: 4-től 19,8-ig; 80 év felett: 13,5-től 27,7%-ig. Az alsó adatok izraeliek végig.
  • Egy tanulmány arról, hogy a "fennsíkra ért görbéjű" (static-phase), azaz 0 feletti szinten folyamatosan hasonló új napi esetszámokat jelentő országokban, amilyen az USA vagy az Egyesült Királyság, alighanem elmarad a tesztelés a kívánatos szinttől, és sok a felderítetlen esetük. Ez viszonylag magától értetődő. Én rögtön kis hazánkra gondoltam, hogy vajon mi mik lehetünk. Egyik nap 50 eset, rákövetkező nap 28, 29, aztán megint 40-hez közelebb. Mi ez? Zsiráf vagy elefánt? Hát, nem lettem okosabb. A tanulmány az "uncertain" kategóriában helyez el minket. A szerzővel együtt érzek.
  • Guido Silvestri olasz-amerikai virológus optimista a második hullámmal kapcsolatban: "Ha valaki légzési nehézséggel jelentkezik majd, és pozitív lesz a tesztje, rögtön antivirális kezelést kap". Igazából nem vagyok ebben én olyan biztos, pedig valójában még korábban, rögtön a nem-specifikus tünetek jelentkezésétől lenne a leghatékonyabb adni ezeket a szereket a vírusreplikáció akadályozására, vagyis a kapcsolatkövető munkának és a logikus következtetésnek nagy szerepe kellene, hogy legyen a CFR csökkentésében.
  • Brazil tanulmány (h/t Epikurosz) a szezonálisat meghaladó halálozásról ott. Extra gondos, mert a korábbi halálozási adatokat a szaporulattal módosult népességre vetítve nézi, úgy veti össze az idei képpel. Porto Alegre megúszta, de a többi jelentős városban (Manaus, Fortaleza, Rio, San Paolo, Recife) mindenütt jelentős a halálesetek száma, és a felderítési arány összességében kb. 52%-os. Ezek szerint a jelenlegi 13240 haláleset helyett lehet kb. 25461 haláleset (azaz +12221). Ebből én Manaus kapcsán 964-et már figyelembe vettem, így a vége +11257. G.a.h. így: +65045+n.
  • MTA-s kutatás a koronavírus hatásáról az agyban.
  • A száj előtt áttetsző maszkok, hogy szájról olvasni tudó süketek emberekkel is lehessen kommunikálni.
  • Nyolcéves gyermek esete, akit, miután (antitestjei vannak) átesett a fertőzésen, szívmegállás ért, de a testvére közbelépésével sikerült megmenteni az életét.

2020.05.15.

Holnaptól új bejegyzés! Közben pedig először is a május 12-én írtak korroborálását is folytatom. Íme, egy cikk. Van benne hasznos táblázat jó pár számunkra érdekes koronavírus hasonlóságáról. Nukleotid- és aminosav-szekvenciák.

sarscov2_crossspeciesevolution.jpgMint látható, a már emlegetett E-fehérjénél ott a 100 százalékos egyezés a ZX45, a ZXC21 és a (SARS-CoV-2-höz már nagyon közel eső) RaTG13 között. Az RaTG13-at tehát 2013-ban gyűjtötték be Jünnan tartományban, a ZX45-öt és a ZXC21-et 2018-ban. Ez az azonosság így éveket ível át, illetve néhány ezer km távolságot Jünnan (Yunnan) és Csöcsiang (Zhejiang) tartományok között, ami azért elég érdekes...

Evolúciós szempontból viszont logikus, hogy a tobzoska-koronavírusok és az RaTG13 (illetve a SARS-CoV-2) hasonlósága relatíve nagy,  már ha tényleg a tobzoska a köztes gazda (dacára annak, mennyire megfogyatkozott a populációja Ázsiában a kínai fogyasztás miatt), és ezt egyszer netán egy nem-kínai tanulmány is meggyőzően kimutatja. A táblázatból mindenesetre ez az elvárható, relatíve nagyobb hasonlóság látszik. Az is "rendben" van, hogy az aminosav-szekvenciák egyezése a nukleotidszekvenciákat tekintve különbségek mellett van jelen. 

Ezek után látjuk az alábbi mutációkat a korábban megegyező szakaszon, lásd alább. Kérdés, hogy ez most azért van-e csupán, mert az emberek közötti terjedés során sokkal komolyabb szelekciós hatásoknak van kitéve a vírus, mint ártatlan tobzoskák között...? Ez ellen szól, hogy szelekciós szempontból nem az E-protein változékonysága tűnik igazán jelentősnek a vírus szempontjából... Vagy egyszerűen a nagy számok törvénye érvényesül, és mivel az emberi populációban a korábbiakhoz képest nagyságrendekkel jelentősebb terjedés megy végbe, ezért látunk nagyobb változatosságot?

sarscov2_eprotein_mutation_pattern.gif

Viszont relatíve kis genetikai változás mellett hogyan ficcent be közben a monumentális jelentőségűnek tűnő furin hasítási hely az S-fehérje esetében? Jackpot a vírus szempontjából? Nézzük kicsit részletesebben.

Még ez az élből a vírus szintetikus jellege ellen érvelő tanulmány is megjegyzi, hogy "Experiments with SARS-CoV have shown that insertion of a furin cleavage site at the S1–S2 junction enhances cell–cell fusion without affecting viral entry. In addition, efficient cleavage of the MERS-CoV spike enables MERS-like coronaviruses from bats to infect human cells. In avian influenza viruses, rapid replication and transmission in highly dense chicken populations selects for the acquisition of polybasic cleavage sites in the hemagglutinin (HA) protein, which serves a function similar to that of the coronavirus spike protein. Acquisition of polybasic cleavage sites in HA, by insertion or recombination, converts low-pathogenicity avian influenza viruses into highly pathogenic forms." Leírja továbbá, hogy "Neither the bat betacoronaviruses nor the pangolin betacoronaviruses sampled thus far have polybasic cleavage sites". Erre reagálva — tudományos érvelésben kicsit szokatlan módon, bár nem életszerűtlenül — azt is mondja egy másik ponton, hogy "it is likely that SARS-CoV-2-like viruses with partial or full polybasic cleavage sites will be discovered in other species", noha egy harmadik ponton az influenza analógiája kapcsán azt is leírja, hogy "The acquisition of polybasic cleavage sites by HA has also been observed after repeated passage in cell culture or through animals". Összegezve, azt írja tehát, hogy: 1) nincs más, hasonló koronavírus eddig; 2) de majd felfedeznek ilyeneket; 3) bár a természetben, vagy éppen in vitro is történhetett az a bizonyos "beficcenés".

Egyebek:

    • Az emberi hülyeség mint történelemformáló erő. Dr. Mitchell Katz, a New York-i közkórházakért felelős vezető New York polgármesterének a korlátozó intézkedések kerülését javasolta márciusban. Katz is a nyájimmunitás félreértelmezett fogalmára hivatkozott az ügyben. És egy ponton hozzátette: "Italy is having a terrible problem that I do not believe we will have". Ennyike.
    • Ha már az emberi hülyeségnél tartunk, íme, az alábbi Trump-támogató egyed betegségének története (azóta elvileg jobban van már). Két hónapon át nyűglődött a kis náthájával, végül még meg is rémült egy kicsit, amikor a vérrögök miatti komplikációk jelentkeztek nála.

sarscov2_billmitchell_story.jpg

  • Vannak dolgok, amiket nem értek. Nálunk volt tegnap 39 új eset, ma lett 37 új (mármint tesztelve és laboratóriumilag megerősítve). Dél-Koreában ennél kevesebb új eset mellett azonnal komoly intézkedéseket hoztak a napokban, és tesztelni kezdtek ezerrel. Nálunk Müller Cecília azt mondja, hogy "nyugvó szakaszba" érkeztünk a járvánnyal. Jut eszembe: Dél-Koreában az esethalálozási arány 2,35%-os, Magyarországon 12,93%-os. Ha a különbséget kizárólag felderítési teljesítményként magyarázom (vagyis nem gondolom, hogy nálunk pl. ennyivel halálosabb SARS-CoV-2-variáns terjed), és Dél-Koreát veszem abszolút benchmarknak, akkor nálunk a mai napig 18936 esetet kellett volna találnunk mostanra. Én nagyon fogok örülni, ha láthatóvá válik, hogy a járvány nyugovóra tér, de az adatok egy kicsit zavarnak még ebben, és nem tudom, mit gondoljak.
  • A koronavírusos eseteink jelentős kórházi koncentrációjáról szóló adatok szivárogtak ki, és Karácsony Gergely főpolgármester itt osztotta meg ezeket. A Portfolio.hu cikkéből
  • Epidemiológiailag szignifikáns adatok arról, hogy egy wisconsini lockdown-ellenes tüntetésen fertőződhettek meg legalább hetvenketten.
  • Az afrikai országok jelentős részének alig vannak kapacitásai, hogy egyáltalán a képet összerakják a járványról. Tanzániában, úgy tűnik, baj lesz. Hivatalosan 509 eset és 21 halott van, az amerikai követség viszont már otthon-maradásra inti alkalmazottait, és túlterhelt kórházakról, valamint országszerte a járvány exponenciális növekedéséről beszél egy közleményben.
  • Nobel-díjjal is lehet óriási baromságokat mondani. Michael Levitt (Stanford — ahol a Ioannidis-féle kritikán alulian shitty science is megszülethetett) még februárban "megjósolta", hogy a kínai járványnak két hónapon belül vége lesz, mert "kiég". Amivel már akkor beégett volna, csak aztán a Kínai Kommunista Párt nekiugrott, és egy távolról sem természetes folyamat részeként (embereket konkrétan ráccsal bezárva a lakásukba, és egyebek) véget vetett az ottani járvány nagy részének ennyi idő alatt. Namármost a kiégés, meg egy hegynek a tábortűzre omlasztása között azért van némi különbség, ezt ugye Nobel-díj nélkül is meg lehet mondani. Levittet ez nem zavarta abban, hogy Írországban a járvány kiégését jelezze előre két héten belülre május 10-én, a korábbi modellje alapján. Nézzük akkor az ír adatokat: május 12.: 107 új eset. Május 13.: 159 új eset. Május 14.: 426 új eset. Akkor tehát még egyszer rögzíteném: Nobel-díjjal is lehet ékes baromságokat mondani. A jó következtetés nem autoritásból fakad.

Május 16-tól új bejegyzés kezdődött.

94 komment

A koronavírus-járvány sűrűjében II.

2020.04.15. 08:08 :: Marton Péter

Előzmények (korábbi kutatási jegyzeteim a témában):

2020.04.15.

  • Nagyon jó cikk a Válasz Online-on a tesztelőkapacitásokat hihetetlenül felpörgetett (persze ugyanakkor nagy járvánnyal küzdő) Törökországról. A számadatokkal ott is lehetnek problémák, nem is kicsik: "nagyon magas a magánkórházak aránya ... (a) török kormány pedig a járványhelyzetben úgy döntött, hogy a koronavírusos betegek kezeléséért ezek a kórházak sem kérhetnek pénzt. Ez viszont tönkretenné őket. Megoldás? Van. Az állami egészségügyben nem bízó betegeket más betegség címén veszik fel a magánkórházba, így pedig már kiszámlázhatják nekik a kezelést..."
  • Az április 10-i Moszkva-Sanghaj járathoz "egy tucat" eset volt visszakövethető Kínában. Közben Vlagyivosztoktól nem messze, Suifenhe határvárosban egy csomó SARS-2-pozitívan visszatérő embert szűrtek ki a határforgalomból. Az orosz helyzet erősen változóban.
  • A GlaxoSmithKline (GSK) és a Sanofi összefognak a vakcinafejlesztésben, ők a G2 ezen a területen.
  • "Data from 5 European countries suggest that care home residents have so far accounted for between 42% and 57% of all deaths related to COVID-19." (Forrás.) (Belgium: 42%, Franciaország: 44,6%, Írország: 54%, Olaszország: kb. 53%, Spanyolország: kb. 57%.)
  • A kínai vezetésről. Miközben az elmúlt hetekben próbálkoztak amerikai biciklistára kenni a járványt, vagy éppen az elektronikus dohányzóeszközök használata (vaping) nyomán keletkező tüdőkárosodások tavalyi, egyesült államokbeli hullámában igyekezett felfedezni a járvány eredetét egy szuperkomputernek álcázott párttitkár, biztos, ami biztos, a koronavírus-járvány eredetével foglalkozó kínai virológusoknak és egyéb kutatóknak kicsit megnehezítik a publikálást, nehogy túlzottan aláássák a sok fantasztikus narratívát. Az jut eszembe, amikor az oroszok nyomták 2014-ben párhuzamosan, hogy az ukránok, az amerikaiak, Soros vagy a mosómedvék lőtték le a maláj utasszállító gépet, vagy nem is lőtték le, csak odavitték. Szóval ezek szerint nem értenék, hogy a túltolt konteózgatás a legegyértelműbb bizonyítékok egyike, ami elképzelhető, a saját (egyébként közvetett) felelősségükre nézve...? Persze én vagyok a naiv — a világban annyira sok, a komplexitást befogadni képtelen elme zakatol, hogy igenis terem ebből számukra babér.
  • Minden idők legokosabb amerikai elnöke közben a WHO-tól vonná meg a finanszírozást legalább ideiglenesen.
  • Egy kicsit bonyibb dolog: a COVID-19 és a vérnyomásbetegség kezelése. Az ACE-inhibitorok és az ARB-blokkolók növelhetik az ACE2 receptorok kifejeződését. Ezért sokan arra jutottak, hogy a hipertóniát akkor jobb lehet nem ezekkel kezelni, mert megkönnyíthetik a SARS-CoV-2 vírusnak a fertőzést (ugyanis az ezt a receptort használja a sejtbe jutáshoz). Akkor pedig jobb lehet az ún. kálciumcsatorna-blokkolókat használni (pl. amlodipine) a vérnyomás kontrollálására. Viszont van másik logika is. Aszerint minden, ami az angiotenzin II (AT II) szintjét alacsonyan tartja, így pl. az ACE-inhibitorok, inkább mégiscsak jó lehet, mert az az ACE2-es receptorok hozzáférhetőségét kedvezően befolyásolja (akadályozza). Most itt egy új tanulmány: ezek szerint az ACE-inhibitorok és az ARB-blokkolók még kedvező hatásúak is lehetnek (pazar leletek: alacsonyabb interleukin-6; kisebb csökkenés CD-3-as és CD-8-as T-sejtek számában; alacsonyabb vírusszám-csúcsszint; végeredményben aránylag kevesebb súlyos megbetegedés). Itt a link a teljes tanulmányhoz (n=42; ebből 17-en voltak ACEI/ARB-rezsimen, 25-en pedig egyéb, pl. kálciumcsatorna-blokkolós kezelést kaptak). Statisztikailag szignifikáns eredmények (P<0.05), de azért ezeket nagyobb populációnál is érdemes lenne verifikálni majd. Számomra ezek után kérdés, hogy a vérnyomásbetegség mint COVID-19-releváns komorbiditás azonosítása nem téves-e részben? (Csak részben, mert a "magas vérnyomás → szív- és érkárosodás → hozzáadódó vírusos szívkárosodás" mechanizmus mindenképpen érvényes egyébként.) Pontosabban az a kérdés, hogy a komborbiditással kapcsolatos megállapítás nem tautológián alapszik-e részben? A SARS-CoV-2 által lekötött ACE2-es receptorok miatt ugyanis borul a renin-angiotenzin rendszer működése, és ez a vérnyomás szabályozását zavarja meg. Kieg.: újabb, a fentieknek megfelelő eredmények, ezúttal az Egyesült Királyságból (h/t Epikurosz).
  • A kórházkiürítések következményeiről, nálunk. "Kétlem, hogy szükség lenne ennyi kórházi ágyra, az eddigi járványügyi adatok ezt nem indokolják" — nyilatkozza a cikkben Dózsa Csaba eü. közgazdász. Ami engem illet, én nem feltételezném, hogy a szervek megalapozatlanul hoztak egy ilyen döntést :(
  • Vezető kutatók adtak tájékoztatást a Fehér Háznak az antitest-vizsgálatok hátteréről és stratégiai jelentőségéről. "There has been concern that some of the tests might confuse the coronavirus causing the current pandemic with one of several coronaviruses that cause the common cold. "Lots of tests confuse the two," Relman said." (David Relman, US National Academy of Sciences.) Ez lehet esetlegesen magyarázat arra, hogyan hoznak ki egyes helyeken jóval nagyobb átfertőzöttségi mutatókat random mintás vizsgálatokból, mint amit életszerűnek gondolna az ember.
  • Itt egy tanulmány, amelyik 2022-ig jósolja szükségesnek a social distancing és egyéb nem-gyógyászati intervenciós intézkedések folytatását az eü. kapacitások túlterhelésének elkerülése érdekében. Ez "absent other interventions" igaz, vagyis ha pl. kapcsolatkövetés, tesztelés, elkülönítés révén nem vágják el a terjedési láncolatokat.
  • Ugyanott izgalmas adatok és becslések a humán bétakoronavírusokról is. Keresztimmunitás az OC43-as és a SARS-1 között. (persze csak addig, amíg az antitestek tartanak). Becsült reprodukciós számok csúcsidőszakra, szezonálisan: 1,85 a HKU-1 és 1,56 az OC43 esetében. Ezek után már szinte biztos vagyok benne, hogy az éves influenzamortalitási adatok sok, valójában koronavírusos esetet darálnak be a statisztikai alapú számítási metódusukkal.
  • Március 28. és április 3. között az ötévi, azonos heti átlaghoz képest +6082 elhalálozás Anglia+Wales esetében. A korábbi konzervatív metódus szerint ennek is csak a felét számítom a járvány extra halálozásához, lefelé kerekítve 3000-re (így az globálisan most +11678).
  • A magyar járványgörbéről. Az össz-esetszám növekedése napi szinten: április 1.: +33; április 2.: +60; április 3.: +38, április 4.: +55; április 5.: +55; április 6.: +11 (vasárnapról hétfőre); április 7.: +73; április 8.: +78; április 9.: +85, április 10.: +210 (amikor egyes idősotthonok a járványügy "látókörébe" kerültek); április 11.: +120; április 12.: +100; április 13. +48; április 14.: +54; április 15.: +67. Nekem ez egy rendetlenségében hiteles, de éppen a rendetlensége miatt inkább a hektikus teszteléssel együtt változó adatsor, ha ránézek. Két rendkívüli adatpont biztosan van (április 6. és április 10., ismert vagy jól sejthető okokból). Amellett pedig 15 adatpontból három lett nullás végű, ami előfordulhat, de azért lehet az adatgyűjtés döccenőiből következő is (forrása lehet pl. backlog és bizonytalanság a tesztelésben). Fura a két egymás utáni napon +55 is. Mindenesetre én nem látok ezekből az adatokból májusban lecsengő járványt, amiről ma beszéltek páran. De persze ne nekem legyen igazam!

2020.04.16.

  • Egy jó beszélgetés a USIP szervezésében a "biztonsági intézmények" szerepéről a járvány kezelésében. Érdekes része pl. ahol kitérnek rá, hogy a táliboktól a libanoni Hezbollahon át brazil és salvadori bandákig mindenféle nem-állami fegyveres/erőszakos szereplők is tesznek korlátozó intézkedéseket a járvány ellenében a maguk területén. A tálibok állítólag karanténoznak is Iránból érkezőket például. Propaganda és talán, legalább, egy csipetnyi őszinte érdekeltség a járvány kezelésében is, egyszerre.
  • Az érfalak belső oldalán lévő endotheliális sejtekben is van sok ACE2-receptor, és a vírust kárt tesz így ezekben a sejtekben is. Többek között ezért is lehet a véralvadás-vérrögképződés komoly probléma COVID-19-nél (a gyulladási folyamatok mellett), annyira, hogy konkrétan adott a DIC (Disseminated Intravascular Coagulopathy, intravaszkulárisan aktiválódó koaguláció) fellépésének veszélye, azzal együtt pedig például thromboembóliás eseményeké (VTE, venothromboembolism; PME, pulmonary microvascular thrombosis; vezethet halálhoz). Összegezzük a vírus lehetséges hatásait: a renin-angiotenzin rendszer megzavarása (vérnyomás...), több lebenyt érintő, szövetközi tüdőgyulladás ARDS-el, szívkárosodás, vesekárosodás, limfocitopénia a T-sejtek támadása folytán, érkárosodás, DIC — csúnya egy lista ez, és gyaníthatóan még így sem teljes. Kieg.: a COVID-19-es DIC-nek már saját neve van, és ismert eltérései a "klasszikus" DIC-től: "COVID-19-associated coagulopathy (CAC)", itt írnak ezekről (bár ugyanott utána "CAC/DIC-ként" utalnak rá).
  • Közben pedig bejött olyan hír, hogy az végképp rendkívüli költségek vállalását indokolja a járvány megfékezésében. Wuhanban és New Yorkban az intenzív osztályon járt betegek 14-30%-ának lett elégtelen a vesefunkciója, és vesepótló kezelésre szorultak vagy szorulnak legalább valameddig.
  • A New York-i mortalitásnövekményről szóló adatokból teljesen világosan látszik, hogy a járványhoz köthető alsó hangon +4780 növekmény az április 4-én végződő hónapban. Lásd alább. 3542 haláleset történt április 4-ig NYC-ben, úgyhogy ez akkor minimum (nagyon-nagyon konzervatívan) +1238 (ezzel globálisan +12916). Látszik egyébként az alábbi görbéből, hogy a szezonális influenzacsúcsokat milyen messze hagyja maga mögött most. Ennyit az influenzával történő összevetésekről. 

nydeaths.png

  • Németországban elhunyt egy 57 éves román férfi az "importált spárgaszedők" közül. Képmutató emberek sóhajtoznak, hogy "hiába" halt meg, aztán majd jól megeszik a spárgát, amit leszedett. Itt egy félelmetesen jó cikk a Guardianben a témáról, bizonyos Costi Rogozanutól, egy román újságírótól — idézem: "the asparagus cutters, salad pickers and care workers represent the most efficient form of labour in Europe: cheap, highly productive, untaxed even if humiliated and a potential public health hazard. Europe’s political economy has created the post-communist universal soldier, capable of converting from farm labourer to caregiver to construction worker as the the season changes. Freedom of movement has morphed into migration for survival and even that privilege is reserved for the physically fit."
  • Erről lemaradtam... Nemcsak Indiában, de Pakisztánban is volt egy szuperterjesztős Tablighi Jamaat-rendezvény, 500+ származékos esettel (helyszín: Raiwing, Punjab, illetve onnan aztán országszerte).
  • Az indiai "érinthetetlenek" sora. A dálit kasztbeliek mit fognak enni? Ez az, ami sokakat Indiában egyáltalán nem érdekel.

2020.04.17.

  • Wuhanban revideálták a halálesetek számát +1290-re. Indoklás: az otthon meghalt betegeket, illetve a kórházakból a sietség és a rendkívüli körülmények miatt nem jelentetteket számítják így be. Anno én +1000-et számoltam a kínai adatokhoz, ismerve a csak CT-alapú diagnózissal rendelkező betegek arányát a laboratóriumi úton megerősítettekhez képest. A mostani plusz mortalitási adat tehát nem ugyanarra a körre vonatkozik. Ha a teljes +1290-et figyelembe veszem az általam követett globális addicionális halálozási adat számításánál (így effektíve duplázott tételként), az rendben lehet a Wuhanban a temetkezési urnáknak a korlátozások feloldása nyomán jelentkezett extra kínálata-kereslete láttán (bőven). Globálisan ez így +14206.
  • A hazai kórház-kiürítésekről, amik két kórház-igazgatóba kerültek mostanra. Mire kell ennyi ágy? Kérdik sokan. Falus Ferenc volt tisztifőorvos pl. felveti, hogy országszerte soha nem egyenletes egy járvány terjedése, miért kell akkor mindenhol? Erre válaszul az én felvetéseim: (1) nem megmondható előre, hol lesz robbanás; (2) a betegeket át is lehet szállítani egyik intézményből a másikba, és akkor mindenhol jól jön az extra kapacitás; (3) ha a járvány bejut (márpedig bejut) olyan intézménybe, ahol legyengült emberek fekszenek tömegével, az garantált mészárlás; (4) ha végre elkezdenék a fertőzöttek korai kezelését, kórházi megfigyeléssel (vérkép, interleukin-6 és egyéb gyulladásmarkerek, limfociták, trombociták stb.), amihez korai tesztelés is kell természetesen, akkor már csak ezért is több hely kellene majd. A kormánynak pedig belejátszhat a kalkulációiba az is, hogy (1) elkerülhetik a felelősséget egy halálosabb kórházi fertőzéshullámmal kapcsolatban; (2) ha pl. lazítják egyszer a kijárási korlátozásokat (amit nagyon nem ajánlanék a populáció extra védelme nélkül, pl. maszkokkal, kiterjesztett teszteléssel, intenzív kapcsolatkövetéssel, pro-aktív elkülönítési gyakorlattal és annak komolyabb betartatásával, illetve legelőször is a terjedési láncolatok egy kritikus hányadának elvágásával), akkor... sajnos akkor is meg tud telni ennyi hely. Ja, igen, és kormányszempontból ott van még az is, hogy az egészségügyi kiadások így... csökkenhetnek.
  • Hát igen, mint ez a cikk kimutatja: a PCR-tesztek költsége tesztenként 7500 Ft körül lehet. Talán nem olyan fontos spórolni ezekkel. Talán.
  • Az "aszimptomatikus hordozók" kérdése kezdi megőrjíteni az embereket, akiknek már elege van az otthon töltött időből. Úgyhogy ez a cikk kötelező olvasmány mindenkinek. Adatok az Egyesült Államokból és Kínából is arról, hogy az aszimptomatikusak nagy része (akár 70%+) egyszerűen "később szimptomatikus", azaz pre-szimptomatikus. Még az ismerőseim között is vannak, akik azt hiszik, hogy már átestek a COVID-en, mert pl. náthásak voltak két hónapja. Valójában lövésük nem lehet róla, hogy hMPV, RSV, influenza, parainfluenza, rhinovírus, adenovírus, "hagyományos" koronavírus (OC43, NL63, HKU1) vagy mi egyéb fertőzésük volt, az pedig közel-biztos, hogy nem a SARS-CoV-2-vel találkoztak.
  • Egy elmélet, részemről: az alighanem nem is olyan gyakori aszimptomatikus lefolyás esetén is okoz károsodást a vírus a szervezetben. Tekintve azt, ami az érfalakkal történik, és pl. a DIC lehetőségét, a mortalitásnövekményként megjelenő plusz halálozások egy része lehet akár a fertőzés nyomán következő hirtelen halál is. Kieg.: jut eszembe, Epikurosz pont idevágó linket küldött a minap. A szívmegállásos halálozások 2020-as görbéje csúnyán elhúzott a 2019-estől New Yorkban. Íme:
  • nycardiacarrestdeaths.png
  • Egy, a nyílt fegyverviselés jogát pártoló michigani milícia (magától értetődően fegyveres) tüntetése a lockdown ellen. Rengeteg őrült dolgot mondanak, de amikor pl. azt mondják, hogy "We are not promised a pathogen-free existence. We do not have a constitutional right to not get a virus", az legalább következetes, még ha életerős, középkorú férfiemberektől önző is, a kockázatok szóródására tekintettel. Kieg.: óriási komment az internet világából: "A zombifilmek ezt sem jelezték előre. Tömegek követelik, hogy a zombik lehetőséget kapjanak a megevésükre". Ain't no constitutional right not to be eaten by a zombie.
  • Fontos üzenet Görögországból olyan döntéshozók figyelmébe (bárhol a világon...), akik PCR-tesztek megspórolásából remélnek gazdaságosságot egy olyan járvány közepén, amelyik egy munkaerő-hiánytól sújtott gazdaság szignifikáns hányadát elintézheti úgy, ahogy van (az idős pedagógusok és orvosok működtette iskola- és egészségügyi rendszerekről nem is beszélve): “There are problems you can solve through spin and others that require truth and transparency. It was very clear we needed experts and we needed to listen to them ... The faster you deal with a health crisis, the greater the short-term economic costs, but then the greater the long-term benefits too.”
  • Bulika a koleszban Észtországban. Afterparty, amíg jönnek a teszteredmények.
  • Random járókelő (60 év körüli férfi) a bolt előtt, ma, itt, nálunk, természetesen maszk nélkül: "Pénzt akarnak belőle csinálni. Arról szól ez az egész. Szarok az egészre!" (Szó szerinti közlésben.)
  • Az orosz vezetés csúnyán elszámította magát olajügyben, a szaúdiakkal folytatott szkanderezésben. Persze az olajfüggő gazdaságoknak most sehogyan sem lehet jó.
  • Egy tanulmány szerint az esetek 11%-ában van vertikális transzmisszió (át a magzatra) terhes nőknél (160 terhes nő 162 újszülöttje alapján). A fertőzés átadása persze egyéb módon is lehetséges, és az újszülött számára ez nem jelentéktelen kockázat (előfordul tüdőgyulladás, ARDS is, többek között).
  • Egyesült Államok: nővérek és orvosok bizonygathatják, hogy munka közben kapták-e el a vírust. Betegszabadságolás és egészségbiztosítás szempontjából ez nem mindegy.

2020.04.18.

  • Néhány fontos dolog az antitest-tesztekről. A WHO is szükségesnek látta már, hogy jelezzék, "vanantitestyeneki =/= indestructiblebyfire", mint azt korábban megfogalmaztam. És egy nagyon jó alapozó áttekintés még a témában mellé. Nekem kritikus kérdés, hogy az antigén, amivel reakciót indukálunk, kellően specifikus-e a SARS-CoV-2-re (pl. endemikus koronavírusok vagy akár SARS-CoV-1 elleni antitestek reagálhatnak-e rá). Emellett egyébként a fals negatív eredmények is megkérdőjelezhetők, mivel lehet, hogy valakinek olyan antitestjei vannak, amelyek nem a teszthez használt antigénhez kötődnek. De legelőször is a fals pozitívok kérdését kell tisztázni, tekintve, hogy a politikusok "back-to-work" tesztként szeretnék használni ezeket a vizsgálatokat. És még akkor is ott van a probléma, hogy IgM =/= IgG =/= immunitás =/= immunitás forevör.
  • Egy érdekes eset Szíriából. Kurd területen vett, tesztelésre Damaszkuszba küldött minta pozitív lett, de a kurdoknak vissza csak 11 nappal később szóltak. Addigra a beteg meghalt.
  • Az EuroMOMO-nál most már kezd látszani jó pár sztenderd eltérésnyi mortalitásnövekmény azokban az országokban, ahol volt/van robbanás (BEL, HOL, SPA, FRA, ITA, UK, SWI, SWE), sőt az első peak, mint olyan. Ha újra szabadjára engednék a járványt, lehet belőle magasabb peak is.

2020.04.19.

Először is az Epikurosz által a napokban küldött linkekkel kezdem, ideje rendesen átrágnom őket. 

  • Ha valakinek drága a 7500 forintos PCR-teszt, van még egyszerűbb megoldás is, marginális költségeket tekintve még olcsóbb, persze kell hozzá az AI, hogy a vérképből következtessen a gépi tanulással felépített profil alapján. Külön nagy jelentősége van annak, hogy ez egy brazil tanulmány (!), vagyis keresnek és találnak megoldást a járvány kezelésére szerény erőforrások mellett.
  • Egy bostoni hajléktalanszállónál elképesztő mértékben találtak aszimptomatikus eseteket. Az eset sokakat foglalkoztat. Ilyen arányokat másutt olyan helyeken sem találtak, ahol pl. szerológiai vizsgálattal igyekeztek megállapítani, mennyi dokumentálatlan eset lehetett (pl. Svédországban, Németországban vagy Kaliforniában); pedig egyelőre azokat is kétséggel kezelem, fentebb jelzett okokból. Az ilyen eredmények aeroszolos transzmisszió mellett működnének csak, nagyon magas R0 mellett. Várnék a következtetésekkel, de gyanús, hogy valamit itt nagyon elrontottak. 
  • Hát, a Magyar Orvosi Kamara azért okkal kérdezi, amit kérdez. Ha abból indulunk ki, hogy értelmesen akarunk működtetni egy országot. Az orvosok kicsit mellékszereplőként vannak kezelve, és ez biztosan nem szerencsés. Ahogyan írják: "a védekezést a belügyminiszter irányítja, a védőfelszereléssel érkező repülőket a külügyminiszter vagy az innovációs és technológiai miniszter fogadja, a kórházakat és a lélegeztetőgép-gyárat a miniszterelnök látogatja, a védekezésről rendőrök és katonák tájékoztatnak". 
  • Iráni "koronavírus-radar". Átmennek full retardba, mert már simán megtehetik, komoly ember úgysem várja tőlük a helyzet valódi megoldását, csak a természetes megoldódás végigasszisztálását. A bolondoknak meg ez is jó lehet.
  • Egy érdekes thread az IL-6-receptort blokkoló tocilizumabról (citokinvihar ellen). Immunoszupresszáns, pl. aktiválhat látens TB-fertőzést, úgyhogy óvatosnak kell lenni ezzel is.
  • Lábon kiütések — újabb lehetséges COVID-19-es tünet, főleg gyerekeknél figyelték meg.
  • Közben a globális halálozás újabb duplázódáson ment keresztül. Ötezertől indult, és ennyi naponta duplázódott 160 ezerig: 10-6-8-6-11. Némi lassulás mostanra — a korlátozó intézkedések hatása érik így be. Amíg tartanak. Közben ma komolyan felvetették nekem, hogy mi van, ha már meghalt mostanra mindenki, aki meg tudott halni ettől a járványtól. Sóhajtok, lapozok.
  • No, hát ezért tartok nagyon a felpörgött antitest-vizsgálatoktól. A tudomány szépsége bennük van, de azzal a politika rútsága sok mindent tud kezdeni. Pl. nem fogják nézni, hogy milyen hihetetlenül bizonytalan alapokon áll, amit nemrég Santa Clara megyében kihoztak kutatók. 1,5%-os átfertőzöttséget mutattak ki úgy, hogy akár az összes pozitív eredmény származhat fals pozitívokból, a konfidenciaintervallum kiterjedését tekintve. A mintavétel sem volt sajnos random, úgy tűnik (Facebookon át rekrutáltak...  szóval mindenki, aki kíváncsi volt, mitől volt beteg két-három héttel korábban, beleugorhatott boldogan, a reprezentativitás szelleme pedig felsírt valahol hangosan). Egy ilyen tanulmány alapján nem szeretnék szaladni sehová. Kieg.: John Ioannidis a tanulmány egyik szerzője. Egy ilyen tanulmány alapján egy zsömlét nem ennék meg, ha éppen azt javasolná. És... hoppá, van, aki egyenesen bocsánatkérést vár a szerzőktől azért, amit elkövettek (hosszú értékelő elemzés vége felé). Kieg.: ez nagyon durva. A tanulmány szerzői közül volt, aki később cikket írt a sajtóba arról, hogy "szakértők azt találták, hogy..." stb., miközben azok a szakértők ők voltak. Ez már a bűncselekmény fogalmához közelít. Nem mondom, hogy ott van, de nagyon messze van a tudományos sztenderdektől. És ha elkezdődik az USA-ban egyes helyeken a "gazdaság újranyitása" c. történet, részben ilyen ócska áltanulmányok miatt, az még tömeggyilkossággal is felérhet, ha úgy veszem.

Mára zárásképpen pedig egy érdekesség. Ezt a guangzhoui éttermi esetet már említettem korábban. Ilyen szépen látszik, hogy a légkondi légárama befolyásolta a transzmissziót. Szóval cseppfertőzés, de mikrocseppekkel, amelyek erős légáramban gyakorlatilag aeroszolok. A trükk az, hogy két irányban is működött a dolog az érintett asztalok sajátos elhelyezkedése miatt, és ahogy ez a légkondi keltette légáramot alakítja — mint az alábbi kettőből a második ábrán megfigyelhető (forrás). Így lehetett az A1-es vendég a forrás a B és a C asztaltársaságok számára is.

ac_infections_covid19.jpg

ac_infections_covid19_b.jpg

2020.04.20.

  • Szingapúrban példás kapcsolatkövetés és járványkontroll után munkásszállókon, vendégmunkások körében alakult ki egy jókora hullám, úgyhogy most kapkodniuk kell. Az érintettek többnyire fiatalok, de ahogy pl. Németországban vagy Szlovákiában is láttuk, a rajtuk átvonuló hullám előbb-utóbb idősebb generációkat is elér. A kapcsolatkövetést viszont nem engedték el azzal, hogy jaj, hát ez így már olyan nagyon sok munka, hogy azt nem is lehet, kellene sok papír, íróeszköz, diákönkéntes meg telefon, á, hát akkor inkább égjen le a ház. Aki nem hiszi, nézze. Mindez nyilvános információ.
  • Az afgán elnöki adminisztrációból negyvenen fertőzöttek, Asraf Ghani egyelőre nem az.
  • Az iszlamisták Bangladesben is csináltak tömegrendezvényt, százezreset, úgyhogy ott is lesz ez-az, csak nem nagyon fogjuk tudni, tekintve a gyenge kapacitásaikat.
  • Új eredmények - megerősítik a korábbiakat - a vírus brutálisan jó környezeti hőálló képességéről. Sokat kell sütni, hogy ropogós legyen.
  • Április elejére már 2500 teljes SARS-CoV-2-genomszekvencia volt feltárva. A hihetetlenül felpörgött genomvizsgálatokból tudjuk már most pl. azt is, hogy "single spillover event" volt a köztigazda és az ember között tavaly novemberben Wuhanban.
  • Hát, továbbra is itt tartunk. Enyhe eset nem eset. Az RTL talált egy kivett mondatot is, mely a Nemzeti Népegészségügyi Központ által kiadott eljárásrendből került ki április 1-re (a március 16-i anyagban volt még benne). A mondat lényeges része úgy hangzik: "Az enyhe tüneteket mutató, otthonában elkülönített betegnél lehetőség szerint történjen mintavétel..." Járványügyileg a "lehetőség szerint" sem lenne jó, de most már ez sincs benne az eljárásrendben.
  • Washington állam, USA: az orosz-szaúdi olajdömping és a COVID-19 miatt előállt keresletszűkülés miatt leállt etanolüzemek miatt nem elérhető, melléktermékből generált CO2-készletek miatt keletkező zavar az ivóvízellátásban (ezért kell ott a széndioxid), és persze zavar ezzel minden szénsavas ital és egyéb termék előállításában is. Komplexitás³
  • Egy rákos beteg esete Philadelphiából, az Egyesült Államokból. Meghalt volna így is, úgy is, de az eü. rendszer hozzáférhetetlenné válása előrehozta ezt jelentősen, április közepére. Teljes joggal tekintik a válság áldozatának — egy járvány mindig több, mint a fertőzés terjedési láncolatainak összessége. (Globálisan így +14207.)
  • Példa járványforgatókönyvre Görögországra vonatkozóan. SEIQRDP-modellt használ, a SIR kompartment-modell jelentősen komplikált változatát, ahol ott vannak a "kitettek" (E), a "karanténezettek" (Q), az elhunytak (D) és vannak nem-fertőzhetők is (in-susceptible, "P"). Így fest a differenciálegyenlet:
  • seiqrdpmodel.png
  • Tömegspektrométeres diagnosztika SARS-CoV-2-vírusfehérjékre.
  • Outbreak. Harbin város és Heilongjiang tartomány, Kína. Kína ismét. Oroszország sincs nagyon messze, de állítólag itt egy, az Egyesült Államokból Harbinba visszatért diák volt az index-eset. Néhány harbini tisztviselőt máris felelősségre vontak nem elég gyors cselekvésért, konkrétan "wishful thinking" (vágyvezérelt gondolkodás), amiért elmarasztalták őket.

2020.04.21.

  • A hirtelen szívmegállások statisztikáját érdemes lesz figyelni majd Magyarországon (is), a New York-i tapasztalatok nyomában. Hogy legyen hozzá baseline, 2008-ból találtam 61/nap (20-25 ezer/év) és 2015-ből 70/nap adatokat. Források itt és itt. Innen pedig az látható, hogy a keringési rendszer betegségei miatt az 1990-2012-es időszakban 175-200 ember halt meg naponta (csökkenő trend mellett).
  • Potenciálisan 32 napig tartó vírusürítés "enyhe" esetnél. Még azzal együtt is figyelemre méltó, hogy "Positive tests may be detecting pieces of inactive viruses, which would not be transmissible in individual cases" (vagyis lehet, hogy csak a vírus-RNS nyomait sikerül kimutatni, tényleges fertőzőképesség nélkül). Mindenesetre ez is egy érv, hogy miért nem lehet az enyhe eseteket figyelmen kívül hagyni. Én az SIR-modellt ebből a szempontból is bonyolítanám. Az I(M) csoport többet fertőz, mint az I(S), ahol M=mild és S=severe. Avagy M=mászkálós és S=sehovánemmenős.
  • Hacsak nem volt stroke-juk a fertőzés előttről, ezért hiba a stroke-ot "alapbetegségként" befirkálni bárhová elhunytaknál. A stroke lehet a COVID-19 része is, különösen nyilvánvaló módon olyankor, amikor súlyos többszervi elégtelenség nyomában lép fel.
  • Ób***meg. Elnézést, de erre ez az adekvát tudományos reakció. A vírus mutációjáról már korábban is volt sok szó, de a koronavírusokról mindig hozzátette eddig a legtöbb forrás, hogy azért nem olyan arányú a vírusgenom változása, mint pl. az influenzánál. Ezek az új adatok nekem most kapásból magyarázzák, miért terjedt lassan a járvány Szingapúrban az első hullámban, és mitől robban most a másodikban. "270-szeres különbség a vírusürítés mértékében"? Ez durva. Azonnal adódó kérdések: mekkora a keresztimmunitás a különböző fajták között? Hogyan hat ez a vakcinafejlesztésre? OMG.
  • Összefüggés a légszennyezés mértéke és a COVID-19-es halálozások között, többek között hipercitokinémián keresztül. Reakcióm, amit már máshová is megírtam: "Simán lehetséges. Egereknél tudok tanulmányról, ahol a finompornak való kitettség és az ACE2-es molekuláris receptorok kifejeződése között találtak összefüggést, alapvetően logikusan előrejelezhető módon (ezek a receptorok — pl. a II-es típusú pneumociták esetében, de azon kívül másutt is — a vírus bejutási pontjai a sejtek belsejébe)." Yaron Ogen itt idézett tanulmánya a nitrogén-dioxid szerepét nézte konkrétan. Hivatkozik egy csomó korábbi tanulmányra is, melyek az NO2-nek való kitettség és a magas vérnyomás, a CVD és a COPD között is találtak összefüggést.
  • Szenzációs kollázs a koronavírus-válságra készült reklámfilmekről. A nagy cégek halk zongoraszóra libbenek be szerény kis emlékeztetőjükkel, miszerint ők életünk stabil elemét képezik már hosszú-hosszú évek óta, ezekben a nagyon nehéz időkben is így lesz ez, és segítenek, együtt vagyunk, tapsolunk örömünkben.
  • Az amerikai olaj futures (előre lekötött) ára 0 dolcsi alatt. Ilyet is megértünk.
  • Nagyon komoly kapcsolatkövető munka Keralában, Indiában. Pathanamthitta járási vezetője annak ellenére végigcsinálta a teljes kapcsolatvizsgálatot (300+ kontakt azonosításával), hogy az Olaszországból érkezett indiai család, akik hozták a fertőzést, nem voltak együttműködők. Rekonstruált mindent, mert tudta, hogy a terjedési láncolatokra kell koncentrálni.
  • A here szövetei sajnos ACE2-es receptorokkal várják a vírust. A sex gap egyik oka lehet, úgy tűnik. Hipotézis továbbá: "Since the testicles are walled off from the immune system, they may be among the last hiding places from which the virus is driven out."
  • A WHO egyik sofőrje életét vesztette egy "biztonsági incidensben" Mianmárban, minták szállítása közben. Kieg.: bővebben. Vagy a mianmari hadsereg, vagy a felkelő Arakani Hadsereg nyitott tüzet az ENSZ jelzéssel ellátott járműre.
  • Sok kórház, vagy kevés kórház a jó? Kérdezz meg egy közgazdászt vagy kérdezz meg valakit, aki látott már járványt. Más választ fogsz kapni.
  • A légitársaságokra váró komplikációkról. Tele járaton nem árt maszkot osztani.

2020.04.22.

  • Egy színész a lábát veszítette el a koronavírus kiváltotta vérrög-képződés miatt, amputálták (közben véralvadás-gátlókkal kezelték, amitől a beleiben vérzés lépett fel). A vérrögök problémájára egyre többen kezdenek felfigyelni. Egy idézet az ehhez kapcsolódó kellemetlenségekről: "We see not just the possibility of blood clots in the lungs," Poor said. In COVID-19 patients who require dialysis because of kidney failure, "their catheters are clotting off every second."
  • A vakcinafejlesztési stratégiákról.
  • Cikk arról, hogy a COVID-19-es tüdőgyulladások sokáig egyáltalán nem tűnnek fel az elszenvedő felek számára. Eleinte anélkül esik nagyon mélyre a véroxigénszintjük, hogy a tüdejük folyadékkal telne meg és elnehezedne. Itt is elhangzik, amit más forrásnál már hallottam, hogy baleseti traumákkal érkező embereknél találnak COVID-19-es tüdőgyulladást. A szerző a pulzoximéter preventív használatát szorgalmazza már az első köhögésektől, hogy lehessen észlelni, kinek romlik az állapota.
  • Ugyanebből a cikkből gondolom, hogy az ún. aszimptomatikus betegek legalább egy részénél anélkül lehet veszélyesen rossz állapot, hogy felfognák: vérrögök képződése és zuhanó véroxigénszint mellett.
  • És szintén ugyanebből a cikkből látni, mekkora vétek az "enyhe" esetek figyelmen kívül hagyása. Lehetne figyelni gyulladásmarkereket, limfocitákat, trombocitákat, véroxigénszintet, lehetne antivirális szereket hatásosabban bevetni (akkor, amikor számít), de inkább jöjjön a beteg, amikor már közvetlen életveszélyben van — erre van kapacitás.
  • Jelentősen megnőtt az Egyesült Államokban a tisztító- és fertőtlenítő szerek általi mérgezések száma. Nyilván másutt is ez lehet a helyzet.
  • A következő illusztráció minőségéért elnézést, iszonyatosan lebutított Paint programmal kellett megcsinálnom. A lockdown-ellenes tüntetések külpolitikai vonatkozású üzeneteiből. Meglepő a nagyrészt republikánus/libertariánus hátterű tüntetőktől* látni a lelkesedést Svédország iránt (máskor Svédországot kb. kommunistának szokták tartani), legalább annyira, mint a "pro-choice", "my body, my choice" típusú érvelést. Észak-Koreát a zsarnokság szimbólumaként említi egy másik tüntető, Kínával fennálló háborúról szól egy további transzparens. A Dump Trump/Abbott Lockdown érdekes texasi bonyodalmak jele (a hagyományosan republikánus fölényű Texasban). *Természetesen vannak emberek, akik simán csak dolgoznának már, mert rászorulnak. (Az amerikaiak többsége közben indokoltnak látja a lockdownt a felmérések szerint.)

antilockdownprotests.png

  • Adatok! A New York Times globálisan (=sokfelé) utánament az addicionális halálozásnak. Nálam +14207-en áll a konzervatívan számolt extra globális halálozás. Nézzük, mi adódik ehhez hozzá továbbra is konzervatív megközelítésben az itt szereplő adatokból... (1) A holland különbözet (márc.9.-ápr.5.) fele: +950; (2) Isztambul - a különbözet fele (márc.9.-ápr.12.): +550; (3) Svájc, a különbözet fele (márc.9.-ápr.5.): +150; (4) Belgium, azonos időszak, a különbözet fele: +350; (5) Spanyolország, azonos időszak, a különbözet fele: +3650; (6) Jakarta, március, a különbözet fele: +450. A többi országnál azért nem adok hozzá, mert korábban onnét más forrásból már számítottam be adatokat, átfedésben lévő időszakra vonatkozóan. Ez így összesen +6100. Globálisan így összesen +20307+n. A járvány halálozása mostanra tehát 200 ezer felett, konzervatív számítással is.
  • A svéd megközelítés árnyoldalairól. Az önkéntes social distancing különösen eleinte a bevándorlók, pl. szomáliak lakta városrészekben kevésbé vált gyakorlattá, mert nem volt az ő tájékoztatásukra megfelelően kimunkált kommunikáció (pl. a közösség megbecsült tagjain keresztül, személyes formában). A fertőzés így ott jobban szétterjedt, majd, ki gondolta volna, idősotthonokban landolt, ahol az ott dolgozók nagyobb része bevándorló.

2020.04.23.

  • Miután stanfordi kutatók kriminális mértékű hanyagságára derült fény a Santa Clara-i szerológiai vizsgálatok kapcsán, itt az újabb botrány, és ez is azt mutatja, milyen tendenciózusan eltúlzott következtetésekkel álltak elő kutatók több helyen a populáció lehetséges átfertőzöttségének mértékét illetően. Két tanulmány is visszavonva Svédországban, az egyik állami, a másik egyetemi. Az állami akkora mértékű átfertőzöttséget jelzett lehetségesnek, amekkorához Svédországénál nagyobb népesség kellene.
  • Egy kis spekuláció. Miért nem lehet nagyságrendekkel nagyobb az átfertőzöttség a kimutatottnál, legalábbis az olyan országokban, ahol tesztelnek minden gyanús esetben? Mert ahhoz a vírusnak dominánsan aeroszolként kellene terjednie, hogy olyan magas legyen az R0 terjedési mutató. Ilyesmire utaló adatunk pedig nincs.
  • Dél-Koreában, ahol rengeteget és pro-aktívan tesztelnek, mindössze 20% volt aszimptomatikus. Ennél lehet valamennyivel több, akit nem vettek észre, de nem nagyságrendekkel.
  • Ugyancsak Dél-Koreából, az imént idézett interjúból: hogyan kerülhető el a felesleges tesztelés pro-aktív és megengedő tesztelési politika mellett: "Ha kifizeti, bármikor teszteltethet. Úgy 140 dollár az ára, de ha pozitív lesz az eredmény, akkor az állam itt utólag megtéríti. Ha az orvos szerint szükséges a teszt, akkor pedig ingyenes." Okos.
  • A hidroxiklorokinról is meglepően logikátlan viták zajlanak. A hidroxiklorokinnak és a klorokinnak cinkkel együtt van igazán értelme, és tényleg olyan, mintha erről a vitatkozók szignifikáns részének egyszerűen nem lenne tudomása. Plusz korán kell adni, nyilván, hiszen a kombó a cinkkel a vírusreplikáció akadályozását célozza — magyarán nem a tüdőgyulladásos betegeket bevárva kellene bevetni.
  • A részben Trump, részben mások, például a francia dr. Didier Raoult által gerjesztett hidroxiklorokin-őrület Indiában kezd halálos lenni. Egy orvos Assam államban meghalt, miután profilaxisként szedte ezt a szert, és most ennek ellenére nyomornegyedek lakóin kísérleteznének vele a szervek (Dharavi és Worli negyedekben, Mumbaiban). Hogy közben ez miként érinti a lupustól szenvedőket, akik rá lennének szorulva a hidroxiklorokinos kezelésre, abba végképp bele sem szeretnék gondolni. (Az assami orvossal közben +20308 a globális addicionális halálozás). Kieg.: az persze érdekes, hogy maláriagyógyszerként a hidroxiklorokin elvileg egész jól működik, és elég széles körű használat ellenére sem jelentettek gyakori problémákat vele kapcsolatban.
  • A dél-koreai védelmi költségvetés csökken, kurtítás (2%-os) a járványvédekezés céljával. Tudnék lelkesedni, ha lenne globális nemzetközi együttműködés, ami jelenleg nincs. És nagyon nem szeretném azt látni, hogy aztán pont a polgáraik egészségével törődő államok jól megszívják. A dél-koreaiak húsba egyelőre nem vágtak: "No delay in introduction or deployment of any equipment is expected due to the budget cut."
  • A válságkezelést illetően a mai EU-csúcs fontos lesz. Nekünk ugye viszonylag szerényen jutott forrás az eddigiekben a finanszírozási forma sajátosságai miatt. A tetejében ezt az EU-ban nem mindenki látja át, és becsúszott még Európa "legeredetibb" (ez nem bók) és következésképpen sokat vitatott rendkívüli kormányfelhatalmazása, amire nem biztos, hogy szükség lett volna, ha utána önkormányzatoknak kell dönteniük parkolók és parkok bezárásáról.
  • Jászberényi Sándor jelenti Egyiptomból. Az egész cikk nagyon érdekes, hirtelen csak egy dolgot említek: az Ikhwan, vagyis a Muszlim Testvériség egyes tagjai ezek szerint arra szólították a hasonlóan gondolkodókat, hogy ha megfertőződnének, fertőzzenek meg minél többeket a kormányhivatalnokok közül. 

2020.04.24.

  • A kórházkiürítéseknek vannak áldozatai. Az a minimum, ha ez alapján a cikk alapján egyet beszámítunk a globális halálozásba is, miheztartás végett (és az így +20309).
  • Közben itt egy eset az Egyesült Államokból, ahol az érintettet nem tesztelték le, meghalt, és körülötte szinte minden családtag fertőzött volt egyébként (az édesapja is meghalt). (+20310)
  • Lesz EU-s mentőcsomag, csak még a részletekről tárgyalnia kell sok európai szuverénnek. Sokat, mert idő az van bőven. 
  • Belpolitika az Egyesült Államokban: a republikánusok bevezették a diskurzusba a "blue state bailout" kifejezést. Demokrata vezetésű állam megmentése nem érdekük, gondolják sajátos érdekkoncepciójuk alapján.
  • Egy nagyon jó videós áttekintés a SARS-CoV-2 vírus lehetséges hatásáról (az ORF-8, ORF-10 és glükoprotein fehérjéken keresztül) a porfirin-vas-O2-globin komplexumra, közismertebb nevén a vörösvértestekben hordozott hemoglobinra, miután az említett vírusfehérjék kötődni tudnak a porfirinhez is, és azon kívül a globin molekula béta-láncához is. Ez pedig kiveti a vasat a komplexumból, és ezzel ellehetetlenülhet az oxigénfelvétel a tüdőn keresztül. De mivel ez csak számítógépes modellezésben jött ki, klinikai megfigyelése (ha előfordul élőben) várat magára. Hipoxémiát COVID-19-nél egészen biztosan képes előidézni a szövetközi tüdőgyulladás, a kérdés tehát az, hogy van-e egy ilyen kiegészítő mechanizmus mellé.
  • EU-s intézkedés: PPE-k gyártásához más körülmények között jogdíjak megfizetése mellett hozzáférhető sztenderdek megosztása a világgal, hogy a világ hozzáférhessen az EU piacához könnyebben, és gyárthasson neki PPE-ket.
  • A U.S. Department of Homeland Security tartott egy prezit elnöki jelenlét mellett arról, hogy a napfény és a fertőtlenítő meg tudja ölni a vírust. Mégis úgy áll, hogy messze nem ez, vagyis a spanyol viasz újra-feltalálása lett azután az esemény leginkább zavarba ejtő része. DJ Trump ugyanis ezt úgy értelmezte, hogy a vírust ezek szerint az emberi testben válik lehetségessé mindjárt napfény vagy fertőtlenítő befecskendezésével pusztítani. 
  • Közben Európában mindenki terveket szövöget az újranyitásra. Gondolkodtam, hogyan ragadjuk meg képletesen a problémát. Sokan azt hiszik, hogy a csökkenő esetszámok olyanok, mint az elálló eső. Valójában a fedezék alatt a fejünkre eső cseppeket számolgatjuk. És valójában a járvány inkább olyan, mint a gravitáció. Ha nem vigyázol, hatni fog — bőven van még fertőzhető ember az útjában.
  • Magyarországi páciens-beszámoló. Érdekes részlet nekem, hogy kismamáról lévén szó, itt féloldali röntgent csináltak: "félig tüdőröntgen (csak a fél tüdőmet nézték, védve a magzatot a sugártól)". Gondolom, ez aligha könnyíti meg a diagnosztizálást. A hordozható ultrahang nem lehet erre megoldás? Már ahol van.
  • Kormányzati kihágásokról is ejtettem már szót itt, itt az ideje, hogy ellenzéki kihágásról szóljak. A fertőzöttek lakhelyét jelölő sárga cédula mint járványügyi intézkedés kapcsán az antiszemitizmust felhozni erősen a valóságtól elrugaszkodott dolog, lássuk be. Nehogy már pont olyan intézkedést támadjanak le, könyörgöm, amikor végre meg van osztva információ valamiről, ehhez nagyon megfogalmatlanodottnak kell lenni.
  • És végül egy kis játék a számokkal. Ha van egy 10 ezer fős populációm, ahol valójában 1% fertőzött, azaz 100 ember, és van hozzá egy 90%-os szenzitivitású tesztem, amivel végigtesztelem őket, akkor 90-et fogok megtalálni a pozitívakból (és 10 főt, vagyis 10%-ot nem fedezek fel). Ha a teszt eközben 4%-ban produkál fals pozitívokat (96%-os specificitás), akkor 400 fals pozitív eredmény lesz a populáció végigszűrése nyomán. Kérdés: ezek után akkor mennyi lesz a pozitív eredményekből fals pozitív összesen? 400/490x100=81%. Hát ezért aggódom, amikor a reprezentatív mintás antitest-tesztek alapján akarják dolgozni vezényelni az embereket. (Ott ráadásul még a minta reprezentativitásával kapcsolatos kétséget is figyelembe kell venni, vagyis hogy a mintából kimutatott arány milyen valószínűséggel véletlenszerű, ami tehát további bizonytalanság.) Persze ha a fertőzöttek tényleges aránya már 20% körüli, akkor a fenti szenzitivitási és specificitási paraméterek melletti fals pozitívok aránya lemegy 18%-ra. Az antitest-teszteknek tehát akkor van értelme, amikor már biztosan tudható egyéb jelekből, hogy az átfertőzöttség mértéke nagy. Aki még ez előtt kezd bele ilyesmibe, annak vagy hátsó szándékai vannak, vagy annyira tájékozatlan, hogy nem érdemes rá hallgatni.

2020.04.25.

  • Először is érdemes megnézni a 04.24. alatti utolsó bevésésemet. Ennek figyelembe vételével tanulságos értelmezni a Mérce cikkét, melynek címe "A kormány végre beadta a derekát...". Hogy osszak mindenkit, ne csak őket, Palkovics László innovációs és technológiai miniszter pedig azt találta mondani: "A kollégáim javasolták, hogy a tesztelések számát növelni kell. A jövő héttől elindul egy reprezentatív vizsgálat, ami abban az értelemben reprezentatív, hogy nemcsak 1500 vizsgálatot fogunk elvégezni, mint Ausztriában, hanem lényegesen nagyobb számot." Nos, a reprezentativitás elsődlegesen ugyebár nem a minta méretéből fakad, mint arra George Gallup még 1936-ban felhívta a figyelmet.
  • Az ebben a cikkben bemutatott tanulmány következtetéseit realisztikusnak vélem, és a kínai diagnosztikai eljárásrend változását itt én is követtem. Kínában ez alapján kb. ennyiszer több eset lehetett a regisztráltaknál. Ezek után érdemes belegondolni, micsoda eredmény, hogy fel tudtak számolni egy ilyen járványt. Politikai rendszert nyilván nem ez alapján választanék, de akkor is. (Itt az eredeti tanulmány.)
  • Mexikóban éppen robbanás történik, és közben az eü. dolgozók elleni erőszaknak is van egy járványa.
  • A kábítószer-kereskedelemre is rájár a rúd. A kínai ellátási láncok nem működnek, az amerikai-mexikói határon elapadt a forgalom, és így csempészni is nehezebb. Márciusban 2582 gyilkosság történt Mexikóban. Érezhető, hogy ez egy erőszakhullám, talán éppen a lehetőségek szűkösebbé válásához kapcsolódóan, a kartellek között. Kieg.: az idézett szám 1997 óta a legmagasabb. Tavaly decemberben volt 2444, júniusban 2543, szóval nem annyira kiugró, de akkor is egy peak jelen állás szerint (az adatok).
  • Ezt a linket a G7-en találtam: a romániai járványadatok. Romániában Arad és Szucsáva (Sucaeva) megyékben a legtöbb fertőzött, utóbbi messze a vezető helyen. Érdekesség, hogy mindkettő határmegye, Szucsáva Ukrajna határán. Kor szerinti megoszlás: a 30-49 évesek teszik ki az esetek 40%-át. Érdekes lesz figyelni a német és brit mezőgazdasági vendégmunka esetleges hatásait. Nem túl meglepő módon eleve Szucsávából kerül ki a legtöbb román vendégmunkás, lásd az adatokat itt (p.44.). (Másféle vendégmunka is van persze: ebben az elhíresült esetben pl. a román hölgyek vélhetően nem idegenvezetőként működtek közre az utazásban.)
  • Ha már vendégmunkások: Szingapúrban 43 számukra tartott munkásszállóban oszlik el 200 ezer fő, itt koncentrálódik a szingapúri második hullám.
  • Zárjuk a napot a legkomolyabb hírrel. SARS-CoV-2-pozitív betegek brutális stroke-kal (Large Vessel Occlusions), viszonylag fiatalon. Itt a Medscape ír erről. Fentebb igazából már megjósoltuk, hogy ez így kell, hogy legyen, sajnos. További rejtett halálozás — így akkor már minden bizonnyal. A koronavirus.gov.hu figyelmébe is: a stroke így nem feltétlenül lehet "alapbetegségként" feltüntethető. Betegek figyelmébe pedig: a fejfájás COVID-19 esetében nem biztos, hogy simán csak egy "tünet", lehet annál több is, sajnos, úgyhogy nem árt ismerni a stroke jeleit. Orvosoknak nyilván a magasabb D-dimer szintre fontos figyelniük például. 

Április 26-tól új bekezdést nyitok ismét, hogy praktikusabb legyen követni az új fejleményeket. Itt érhető el.

34 komment

Lassa-láz, Nigéria

2020.04.06. 16:46 :: Marton Péter

Ha már úgyis a globális közegészségügyi témák vannak most napirenden, szánok itt egy bejegyzést a nigériai Lassa-járványnak is, méghozzá az alábbi trendek miatt. Globális fenyegetésről itt nincs szó, de a trendeket tanulmányozni akkor is érdemes:

lassa.png

  • Felfedezve: 1969, Lassa, Borno szöv. állam, Nigéria.
  • RNS-vírus.
  • Előfordulás: Nigéria, Libéria, Sierra Leone, Guinea, Ghána (Nyugat-Afrika déli részén). Érdekes kérdés, hogy Ghána, Togo, Elefántcsontpart és Benin esetében miért alacsonyabb a szeroprevalencia — ez így lyukat üt a Lassa-övezeten, kettéválasztva két elsődlegesen érintett területet egymástól.
  • 7-21 napos inkubációs idő (tipikusan 10 nap körül)
  • 80%-ban nagyon enyhe vagy aszimptomatikus esetek.
  • Kezdeti tünetek jellemzően: láz, levertség, gyengeség, izomfájások. Az esetek 20%-ában súlyosbodás: fejfájás, gyulladt torok, hányás, köhögés, mellkasi fájdalom, hasi fájdalom. További súlyosbodás, innentől VVL-ként (mint vírusos vérzéses láz): tüdőfolyadék,  felduzzadt arc, légzési nehézségek, vérző foggumók; a vérzés kiterjedhet: szájat, orrot, gyomor-bélrendszert érintheti (e forrás szerint a tüdőt is), és jöhet lezuhanó vérnyomás. Sokk, görcsrohamok, dezorientáció, kóma követheti ezeket.
  • Mindezt limfopénia és trombocitopénia kíséri.
  • Máj, lép és vesék károsodhatnak.
  • A hospitalizációra kerülő esetek 15-20%-ában halálos kimenetel, átlagosan 14 nappal az első tünetek jelentkezése után.
  • Probléma: mivel a nem-súlyos tünetek abszolúte nem-specifikusak, pláne egy malária sújtotta régióban, a súlyos esetek általában kezeletlenül és késéssel kerülnek kórházba. "Differential diagnoses include severe malaria, typhoid fever, other viral haemorrhagic fevers, leptospirosis, typhus, tick-borne relapsing fever, non-typhoidal salmonellosis, meningococcal septicaemia and meningitis" (forrás). 
  • Mindebből az is következik, hogy a prevalenciára csak becslések vannak. Laboratóriumi diagnosztika még a súlyos eseteknél sincs mindig.
  • Terhes nők a harmadik trimeszterben különösen veszélyeztetettek. A fertőzöttek között a nők előfordulása 1,2-szeres. Fiatalabbak betegszenek meg jellemzően (21-30 éves korosztály).
  • A tünetek jelentkezése után 3-9 héten át távozhatnak vírusrészecskék a szervezetből, széklettel.
  • Hosszú távú komplikáció lehetősége: hallásvesztés, a súlyos esetekből felgyógyulók 25%-ánál, 1-3 hónap elteltével részleges visszatéréssel. (Tehát a központi idegrendszert is megtámadja a vírus.)
  • Természetes forrás: a Mastomys natalensis rágcsáló (angol nevén multimammate rat, azaz többemlőjű patkány) populációi, melyek egyedei nem betegednek meg a vírustól, de a vizeletükön-székletükön keresztül terjesztik azt. Az ember közelében élnek, előszeretettel kolonizálnak emberi településeket. A porba kerülő vizeletükből és székletükből visszamaradó vírus aeroszolként kerülhet a tüdőbe. Élelmiszereket is beszennyezhetnek. Olykor meg is eszik ezeket a patkányféléket emberek — bozóti vadhús. 
  • A megelőzésben a rágcsálóirtás, az élelem biztonságos tárolása, a megfelelő hulladékkezelés és a kézhigiéné is segíthet. Csupa olyan dolog, amire rurális nyugat-afrikai területeken általában nem annyira adott a lehetőség.
  • Emberről emberre is terjedhet, leginkább testnedveknek való kitettséggel járó kontakt mellett. Magzatnak átadható (a méhlepény/placenta szövete a vírus célsejtjei közé tartozik). Nemi úton is átadható a fertőzés.
  • Importált esetek időről időre előfordulnak, még Európában is (jó nehéz felismerni őket, bár paleo-bozóthús fogyasztása végett a közelmúltban Nyugat-Afrika valamely rurális részére tett turisztikai kiruccanás említése eligazíthat). 1969 és 2015 között 30 feljegyzett importált eset volt ezekben az országokban: Egyesült Államok, Németország, Egyesült Királyság, Hollandia, Izrael, Kanada, Japán, Svédország. Egyik sem vezetett továbbfertőzéshez. "In the past 10 years, EU/EEA countries have reported five Lassa fever cases to The European Surveillance System (TESSy). Two cases were reported by the UK (ex-Nigeria and ex-Mali) in 2009, one by Sweden (ex-Liberia) in 2016 and two by Germany (ex-Togo and a secondary case infected in Germany) in 2016. In literature, an additional imported Lassa fever case was reported from Sweden in 2011 (ex-Sierra Leone)" (forrás).
  • 1% körüli CFR (amennyire az évi "valahány százezerből" az évi "valahány ezer" halott alapján ez számolható).
  • Kezelés: folyadékpótlás, Ribavirin (favipiravirral kombinálható).

Az Arenaviridae család tagjai. Ennek eddigi felfedezettjei:

arenaviridae.png

A fentiek földrajzi előfordulása. A Lujót én rajzoltam be hozzá, Lusaka városához kötve, mert onnét bukkant fel az eddigi egyetlen ismert alkalommal.

arenaviridae2_1.png

Az idei Lassa-járvány és az évek óta növekvő trend okai lehetnek például:

  • Heves esőzések nyomán több termény, több élelem a rágcsálóknak.
  • Több terület bevonva a mezőgazdasági termelésbe, több élelem a rágcsálóknak.
  • Megerősíti a fenti két feltételezést, hogy a majomhimlő (a fekete himlőt okozó variola vírus családjából, a Poxviridae-ből) is nagyobb járványt produkált idén Nigériában, és azt is rágcsálók terjesztik, többek között.

További érdekességek:

Így néz ki a kapcsolatkövetés, amikor egy európai ország tényleg meg akar állítani egy járványt: "Dutch public health authorities have identified 132 risk contacts among Dutch citizens in the Netherlands and in Sierra Leone, including 19 high-risk contacts." Mindezt egy emberről emberre viszonylag nehezen átadható betegséggel kapcsolatban. A Lassa-lázas esetet 2019. november 20-án azonosították Hollandiában, Sierra Leone-ból történt orvosi evakuáció nyomán, akkoriban, amikor a SARS-CoV-2 elindult globális körútjára a kínai Hubei tartományban.

Folyt. köv.

2 komment

A koronavírus-járvány sűrűjében

2020.04.04. 10:55 :: Marton Péter

Előzmények:

2020.04.04.

      • Tökéletesen egyértelmű esettanulmányok Szingapúrból a pre-szimptomatikus terjesztés lehetőségéről. Ha valaki még nagyon kételkedett volna, bár annak lehet, hogy mindegy.
      • Dél-Olaszországban a közrend egy picit megrendülőben. Még csak apró kis rezgések, ahhoz képest, ami lehet. Tömeges nem-fizetés szupermarketben, élelmiszerszállítmány elrablása egy fuvarostól.
      • Ezen a felvételen (Hadházy Ákos megosztása a You Tube-on) állítólag a Nemzeti Népegészségügyi Központ részéről mond valaki szakmailag vállalhatatlan dolgokat. "Szűrővizsgálatként" utal releváns kontakt és kitettség nyomán tüneteket mutató, munkája során nagy számú munkatárssal érintkező, COPD-s idős édesanyjával egy háztartásban élő ember letesztelésére, teljesen komolytalanul, és azt mondja, hogy csak bizonyos panaszok alapján lehetséges a tesztelés, főleg "ágyban fekvő betegeknél", "meg egyebek". Egyéb, a videóban elhangzó állítások nyomán remélem, nem az ecuadori forgatókönyvet követjük. És leírnám még általános elvként: az értéke annak, ha ARDS-el kórházban fekvő (CT-vel már korábban tökéletesen diagnosztizálható) betegnél kimutatják a koronavírust: KÖZEL NULLA. Az értéke annak, ha a jelentkező tüneteknél sikerül diagnosztizálni, még az elején: KÖZEL MAXIMÁLIS. A pre-szimptomatikus diagnosztizálás az igazi főnyeremény. De lehet, hogy inkább focianalógia kell ide. ARDS-es haldoklónál a diagnózis = kiharcolni egy szögletrúgást, mikor az ellenfél 5-0-ra vezet, a 89. percben. Pre-szimptomatikus esetet felderíteni = bejutás a BL-be. Ennek fényében értelmezendők a felvételen hallható dolgok.
      • A halálozások alulmérése Olaszországban (WSJ). Még korábban beszéltünk a kommentek között arról, hogy az EuroMOMO mortalitásfigyelő Olaszországra annak ellenére jelez a sztenderd eltérés hatszorosának megfelelő értékű mortalitásnövekményt (heti adatok között, 4,5 év mozgó átlagához képest), hogy az egy országos szintű adatban jelenik meg, miközben Lombardiában koncentrálódik igazán a probléma. A WSJ utánament, és a következők jönnek ki: Bergamóban 2060 halott, Bresciában 1278 halott hivatalosan COVID-19-ben, tartományi szinten, márciusban — ezeknek legalább kétszerese halhatott meg (+4500 halálozásnövekmény a tavalyi azonos havihoz képest). Idősek otthona Coccaglióban (Brescia tart.) 24 , Lodiban 38 halottal (márciusban) — senki nem volt itt tesztelve, és Franciaország a napokban ismert el ilyen okból 800+ halálesetet. Az idősotthonokból nem futnak be az adatok közvetlenül az országos összesítésekbe sok helyen, talán Európa-szerte. Coccaglióban +50 mortalitásnövekmény a tavalyi havi átlaghoz képest márciusra (az említett idősotthonnal együtt, feltételezem). Castellone (Cremona tart.): +26 mortalitásnövekmény. A teljes mortalitásnövekmény érdekes, mivel a járványhelyzet miatt egy csomó ember maradt ellátatlanul, és ez is halálos volt. Bergamo tart. + Brescia tart. + Lodi + Castellone így = 3402 a WSJ által javasolt konzervatív duplázással Bergamo és Brescia esetében. Egyébként van olyan kutató is, aki +6000 halálozással számol, 100%-ban figyelembe véve a teljes mortalitásnövekményt a két, fentebb említett tartományra. (Globálisan a konzervatívabb számítás nyomán mostanra 5889+n extra haláleset a hivatalos adatok felett, ahol tartunk.)
      • CDC-féle elemzés arról, egy kínai esetből dolgozva, hogy a légkondi a cseppfertőzések hatókörét hogyan nagyítja fel, és hogy valószínűleg ez a magyarázat arra, hogy nem minden ismert transzmisszió magyarázható szoros kontakt melletti cseppfertőzéssel.

2020.04.05.

  • Angliában baj van. Sokak központi idegrendszerét támadta meg valami, és képtelenné váltak a logikus gondolkodásra, ijesztő mértékben. Az 5G-hálózattól rettegnek, mert szerintük koronavírust terjeszt.
  • Brazíliában nagyon beindult a járvány, és valószínűsíthetően nagyrészt a statisztikákban meg nem jelenő módon terjed és öl. "Cemeteries in São Paulo are burying 30 to 40 people a day with coronavirus symptoms but, in most cases, no test result."
  • A különféle kábítószerek, pszichoaktív szerek, fájdalomcsillapítók felhasználóira is nehéz idők várnak. Gyorstalpaló társadalmi érzékenyítés, ha valakinek erre szüksége lehet: az érintettek között lehet Béla, akinek a fizikai munkától tönkrementek az ízületei és nem bír a krónikus fájdalommal máshogyan együttélni, vannak ott gyerekkorukban bántalmazott, traumatizált emberek, olyan társadalmi miliőben felnőtt emberek, akiknek ez jutott stb. A szükségleteiket megpróbálhatják valamilyen helyettesítővel kielégíteni, és annak rossz következményei lehetnek.
  • Nagyon okos megoldás Heidelbergben, hogy tudják, melyik eredetileg enyhe eset indulhat meg a lejtőn: "They call them corona taxis: Medics outfitted in protective gear, driving around the empty streets of Heidelberg to check on patients who are at home, five or six days into being sick with the coronavirus. They take a blood test, looking for signs that a patient is about to go into a steep decline. They might suggest hospitalization, even to a patient who has only mild symptoms." Persze ehhez először is tudni kell, kik azok az enyhe esetek, ezt pedig tesztelés nélkül nem lehet.
  • A fentebb idézett cikkből, arról, hogy el lehet-e engedni a kapcsolatkövetést: "“Testing and tracking is the strategy that was successful in South Korea and we have tried to learn from that,” Professor Streeck said. Germany also learned from getting it wrong early on: The strategy of contact tracing should have been used even more aggressively, he said."
  • Egy nagyon jó kis beszélgetés Angela Rasmussen virológussal (Columbia). Sok apró érdekességgel szolgált, pl. kitérnek az ADE (Antibody-Dependent Enhancement) esetleges szerepére is, és hogy ez a SARS-CoV-2-nél egyelőre nem valószínű, mert nincs arra utaló jel, hogy a vírus a makrofágokat fertőzné sikeresen, ahogy teszi ezt pl. a dengue. (Megjegyzés: attól, hogy nincs arra utaló jel... a 2002-2003-as SARS-t és később a MERS-t nem nagyon volt lehetősége újra elkapniuk az embereknek, szóval az alapján nehezen lehetne jel.)
  • Komoly viták magyar közgazdász körökben a jegybanki pénzteremtésből vagy állami kötvénykibocsátásból injektálható keresletbővítő helikopterpénz szerepéről a gazdasági helyzet (illetve a vállalatok és a háztartások egzisztenciális kihívásainak) kezelésében.

2020.04.06.

  • Az ATV esti műsorában Sváby András interjúvolt egy felgyógyult magyar beteget, aki elmondta, hogy a megfertőződése napján délelőtt még vígan squasholt egy barátjával, aztán eléggé beteg lett (letargikus, konfúz, nehézségei voltak a beszéddel, a lakáson belüli mozgással). És persze senki nem tesztelte, sőt még az orvosi ismeretséggel mozgósított háziorvos is azt mondta neki, jobb, ha nem megy sehová, mert olasz nyaralás és ismert kontakt hiányában úgysem tesztelnék. Ami nyilván szuper hír a squasholós barátnak. És a barát családtagjainak. És a baráti családtagok ismerőseinek. És a baráti családtagok ismerősei nyomán azok családtagjainak. Satöbbi. Tecikérteni?
  • Thaiföldön meghalt egy 25 éves magyar állampolgár, a Bagla Road-i piroslámpás negyed visszatérő látogatója e szerint a thai lap szerint. A nem annyira beleszarós thai hatóságok 35(!) magas kockázatúnak minősített kontaktját kutatják, hogy elvágják a terjedési láncolatokat.
  • A New York Times megszerezte a WHO magyarországi irodáját vezető Ledia Lazerinek egy táviratát, melyből kiderül, hogy a WHO értékelése szerint már március második hetében community spread volt Magyarországon (értsd: követetlenül fertőzött a vírus a városi vadonban). Nekem ebből annyi a hír, hogy a WHO képes volt megfelelő következtetésre jutni legalább privátban. Amúgy józan paraszti ész kérdése a dolog. Ha az inkubációs idő átlagosan 5-6 nap (de lehet hosszabb is), és egy beteg átlagosan 10 nap alatt jut el az elhalálozásig, ha úgy alakul, akkor ezzel számolva elég felidézni a kórházakban annak idején ismeretlen forrásból felbukkant, a sajtó által is megírt vírusostüdőgyulladás-eseteket.
  • Boris Johnson kórházban.
  • Hiány-közeli állapot gyógyszerekből, altatókból, nyugtatókból az USA-ban. Kritikus kérdés pl. a betegek lélegeztetésénél.
  • Eset. 30 éves férfi halála az Egyesült Államokban. A felesége nagyon enyhén volt beteg, ő úgy kapta el a vírust, otthon. Ő belehalt, de a nemritkán látott váltakozó fázisos lefolyással. Volt egy nap közvetlenül a halála előtt, amikor egészen jól érezte magát újra, étvágya volt, mozgott.
  • Kórházi intenzív osztályi el-nem-látás miatt per indul Belgiumban.
  • A magyar fertőzöttek 12%-a egészségügyi dolgozó (forrás: Müller Cecília).
  • Ebben a beszélgetésben — nem alaptalanul — a túlsúlyt nevezik az egyik legfontosabb kockázati faktornak COVID-19-nél (persze életkor, diabétesz, magas vérnyomás stb. mellett). És még egy figyelemre méltó epidemiológiai megállapítás, bár nem kemény adattal alátámasztva: olyan helyeken terjed különösen gyorsan a járvány, ahol az emberek sokat esznek házon kívül.
  • Az Egyesült Államokban közben a szövetségi tagállamok kezdenek egymás ellenében bevezetni mozgáskorlátozó és populációszűrő intézkedéseket. Pl.: Texas vs. Louisiana.
  • Egy húgyhólyagrákos férfi vesszőfutása. Sok szempontból érdekes eset. Nem kap immunoterápiás kezelést a járvány miatt. Az immunoterápiás kezelés formája: BCG-oltás. Az oltóanyagban lévő baktériumok (az emberre nem borzasztóan veszélyes, de azért kórokozóként viselkedő Mycobacterium bovis) miatt csak védőkesztyűben lehet beadni, és az — állítólag — nem állt rendelkezésre, amikor a kezelés esedékes lett volna, ezért nem lőtték el rá a BCG-oltást.
  • Ebből a tanulmányból az derül ki számomra, hogy elképzelhető, hogy az olaszok genetikailag voltak ideális célpontok a vírus terjedéséhez és nem a véletlen műve, vagy intézményi okokból fakadó dolog, hogy ott robbant fel a bomba. Egyéni szinten pedig kész genetikai lottó, ahogyan pl. az ACE-2-es receptorok sokfélesége egyéni szinten szórja a kockázatot (egyéb, hasonlóan ható tényezők mellett), és a teljesen tünetmentes esetektől a gyors összeomlásig mindenféle lefolyást lehetővé tesz.

2020.04.07.

  • A koronavirus.gov.hu-ról mára megtudhattuk, hogy a traumás fejsérülés és a combnyaktörés alapbetegségek. Sőt, koronavírusos elhalálozást valószínűsítő alapbetegségek.
  • Boris Johnson intenzív osztályon.
  • A bronxi állatkerti nagymacska-fertőzésekről tegnap elfelejtettem említést tenni.
  • Elegáns kísérlet a beszéd általi cseppfertőzés-terjesztés demonstrálására, ami az aszimptomatikus hordozóknál különösen jelentős (hiszen még nem köhögnek, tüsszögnek. "We found that saying the words 'Stay Healthy' generates thousands of droplets that are otherwise invisible to the naked eye." Humora is volt a kutatóknak.
  • Japán. Jelenlegi hivatalos adatok: 3906 fertőzött, 92 haláleset, 592 felgyógyult, 79 kritikus állapotban. Lélegeztetőgépek száma: 22 ezer. Használatban jelenleg: 40%+. (Nyilván nem csak a koronavírus miatt lehetnek használatban, de a 40% az akkor is 8800, és ez elgondolkodtató.)
  • Kiváló áttekintés arról, hogyan befolyásolja az esetszámok értelmezését a tesztelési stratégia — nem egyszerűen az, hogy többet vagy kevesebbet tesztelnek, hanem hogy mikor és hogyan növelnek (vagy esetleg csökkentenek).
  • Ecuadorban annyira brutálisan rossz a helyzet, hogy azt nehéz értelmezni. "The city announced Saturday that it's giving out 2,000 pressed cardboard boxes to people to give deceased loved ones a "dignified burial" during the coronavirus pandemic."
  • A szükség nagy úr, és kiderül, hogy az ultrahang nem is olyan rossz a COVID-19 diagnosztizálásához. A CT-nél a sugárzás még hátrány is, az ultrahang pedig pont ennek a hiánya miatt gyorsan ismételhető. Kevesebb a gond a fertőtlenítgetéssel. A hordozható ultrahang az új sztetoszkóp! (És még a denevérek is szeretik... az ultrahangos képalkotást.)

2020.04.08.

  • Március 9. óta a halálesetek száma négyszer duplázódott, 5000-től 80000-ig. A duplázódások között eltelt napok számának sorozata: 10-6-8-6. Aktuális összegzés hivatalos adatokból globálisan: 82143. Ezen felül általam azonosított halálesetszám: 5889+n. Viszont mindjárt jön újabb extra tétel.
  • Az Egyesült Királyságból van most adat az országos statisztikai szolgálatuktól (ONS) a hivatalos adatokon felüli halálozásról. Mint most egyértelműen kiderül, a UK-ben is a kórházi adatokat összegezték csak eddig. Patrick "Let's Go for Herd Immunity" Vallance szerint "The UK is using the "international reporting standard for deaths," he added, which he described as "hospitalized deaths confirmed." Ebből +642 haláleset adódik a március 5. és 27. közötti időszakra. Globálisan így az extra halálesetek = 6531+n.
  • A negyedik amerikai repülőgép-hordozót érinti már a járvány. Ennek fele se tréfa: a globális katonai stabilitás szempontjából komoly következményei lehetnek (Észak-Korea, Dél-kínai-tenger, Tajvan, Közel-Kelet). Érintettek: USS Theodore Roosevelt (Vietnamban szedte össze az első fertőzéseket), USS Ronald Reagan (Japánban), USS Carl Vinson (Puget Sound, Washington state, US), USS Nimitz (Washington state, preparing for deployment...).
  • Közben egy francia repülőgép-hordozó is beteg már: a Charles de Gaulle.
  • Antarktiszi sétahajókázás: 217-ből 128-an fertőzöttek már, Uruguay kórházait terhelik meg extra esetekkel éppen.
  • A koronavirus.gov.hu-n ma le van írva, hogy hivatalos oldalról nem kíváncsiak a járvány felderítésére túlzottan. Azt írják: "Fontos tudni, hogy a koronavírus-járványnak már abban a szakaszában tartunk, amikor bárki és bárhol fertőzött lehet. A laborvizsgálattal beazonosított fertőzöttek számánál jóval magasabb lehet a tényleges fertőzöttek száma. A járványt tehát a laborvizsgálat sem tudja megállítani..."
  • Az adatok közlésével kapcsolatban az a kérdés jutott eszembe, hogy vajon a "magas vérnyomás" mi alapján kerül oda. Dokumentált hipertóniás előtörténet alapján, vagy kórházi mérésből? Két adatpontnál konkrétan "magasvérnyomás-betegség" szerepel beírva. A kórházi mérés pedig olyan betegségnél, ahol a vírus közvetlen hatást fejt ki a renin-angiotenzin rendszerre, durván torzíthatja a képet. Ahogy a dolgok most állnak, az első ötven áldozatból 40%-nak volt "magas vérnyomása", de csak 2 főnél írták ezt le "betegségként". Ez most akkor simán következetlenség, vagy éppen hogy így pontos?
  • Wales. Intenzív osztályi orvos beszél a tapasztalataikról. Csak ötvenes éveikben lévő és fiatalabb betegeik vannak. A hozzátartozók napi szintű tájékoztatását is megszervezik. Gyakorinak mondja a már felépülőben lévőknél fellépő szívelégtelenséget (részben a vírus okozta szívkárosodás miatt) halálokként.
  • Dr. Britt Glaunsinger előadása a koronavírusokról. Denevér-koronavírusokból itt idézett becslés szerint 5000-nél több lehet, és eddig 500-at sikerült izolálni (pl., teszem hozzá, ott van az SHC014-es, amelyikkel a híres  2015-ös tanulmány foglalkozott, a SARS-CoV-1-essel történt keresztezése kapcsán). Nagyon érdekes látni azt is, hogy az S-fehérjének a receptorkötő doménje (ez kapcsolódik az ACE-2-es receptorokhoz a sejtmembránon) mennyire változékony, miközben ugyanott a mögötte készenlétben álló fúziós gépezet nagyrészt konstans. És még sok egyéb trükk, pl. a riboszóma szükség szerinti pauzázása és hasonló finomságok az RNS-replikáció során.

2020.04.09.

  • Ecuador. "The government has recovered 1,350 bodies from Guayaquil’s homes." 400 ecuadori, már korábban figyelembe vett halálozás nyomán globálisan így az extra halálesetek = 7481+n. (Ezekkel már egészen biztos, hogy ma átlépjük a 100000 halálesetet — hivatalosan persze majd csak holnap.)
  • Az ecuadori helyzet alapján egy nagyon világos kérdés fogalmazható meg, mely úgy hangzik: WTF? Értem, hogy Spanyolországgal vannak kapcsolatok, és pl. Argentínába is spanyolból érkezők (pl. Juan Giménez, a híres képregény-grafikus) vitték a fertőzést, de azért itt a halálozás olyan léptékű és mértékű, hogy az olasz esethez hasonlóan extra magyarázatot kívánhat.
  • A brit NHS tele van bevándorló orvosokkal, akik közül nyolcan haltak meg eddig. A Brexit és az idegenellenesség ennek fényében... persze ezek komplex kérdések, tudom.
  • Edzeni jó, de gyilkos dolog lehet mások közelében csinálni, zihálva. Belga-holland tanulmány futók, biciklizők figyelmébe. A mikrocseppfertőzés lehetőségéről alap ez a videó.
  • És akkor egy közérdekű érv, Hollandiából hallottam. Azért is kell a vállalkozásoknak a gazdasági segítség, mert ha nem aggódnak az egzisztenciájukért a vállalkozók, ők is inkább otthon maradnak. Basszus, ez alap, de tényleg.
  • A politikákat a kulcsfontosságú emberhálózati csomópontokra kell hangsúlyozni. Maszkot legelőször is nekik. Oltást nekik. Szűrővizsgálatot nekik. Kontaktvizsgálatnál extra óvatosság velük, akkor is, ha "alacsony kockázatúnak" tűnnek. A fontos csomópontok ugyanakkor helyek is lehetnek. A tágabb kérdéstől elszakadva egy specifikus példa: például azok a helyek, ahová a karanténból kirándulók tömegével autókáznak ki egy kis levegőzésre
  • Így néznek ki a napi szintű tájékoztatók Hollandiában. Mindenhol visszaesőben az ICU-kba érkezők (Figuur 2-5). Úgy tűnik, sikerül kezelniük a helyzetet (persze annak ehhez előbb nagyon el kellett romlania sajnos).

A holland esetek megoszlása korcsoport szerint + kórházi kezelésre felvéve + halálozások (a 3 oszlopban, balról jobbra). Íme (Tabel 3):

tabel3.png

  • Továbbra is a fenti holland anyagból. Súlyos sex gap a mortalitásban. Nők adták az intenzív osztályra kerültek 53,3%-át, de az elhalálozottaknak csak 38,5%-át! (Tabel 4.)
  • Az intenzívre kerültek 45,7%-ánál volt komorbiditás, de a halálesetek 68,6%-ánál ugyanakkor (Tabel 5a). (Érdekes összevetni, hogy a magyar adatok szerint 100%-nak van komorbiditása — valamit alighanem máshogyan mérünk. Egy különbség, amit rögtön látok (Tabel 5b), hogy a magas vérnyomást ők csak CVD (kardiovaszkuláris betegség) esetén írják be komorbiditásnak.
  • A szaúdiak egyoldalú tűzszünetet hirdettek Jemenben. Az előkelő családok tagjai közül vagy százötvenen fertőzöttek mostanra, az uralkodó egy vörös-tengeri szigeten igyekszik átvészelni ezeket az időket (80+ éves).
  • Gangelt Németország Wuhanja, úgy emlegetik. Karneválozás volt, jó sokan megbetegedtek mostanra. A cikk végigveszi, hány hasonló nagy klaszterről tudunk egy-egy eseményhez kötődően. Én itt még több ilyet is említettem már. És akkor itt egy újabb: Albany, Georgia, US. Két temetés  további temetések. Ezt a Húsvét idején (remélhetőleg nem) tervezett összejövetelekre gondolva is érdemes észben tartani, és az ilyenre készülőket érdemes nagy gondossággal elkülöníteni mindenkitől.
  • Az utóbb említett cikkből: "Murray, 75, was hospitalized. She had a fever and her blood pressure skyrocketed." Ezért hiba beírni a magas vérnyomást önmagában komorbiditásként.
  • Rossz hírek: a fertőzésen átesettek egyharmadánál nem-kielégítő antitest-mennyiség (review előtti tanulmányból); egyeseknél nem is volt észlelhető antitest. A betegség súlyossága nekem korrelálni látszik az antitest-szinttel egyébként, vagy ezt gondolnám, az alapján, hogy pont az idősebbeknél voltak magas szintek, a 15-39 éves korosztálynál pedig alacsonyabbak. Bár azt írják, hogy a kor szerinti megoszlás egyébként úgy jött ki, hogy a "disease duration" változó gyakorlatilag kontrollálva volt... szóval fura. És az átoltás lehetősége szempontjából elég gáz, hogy még néhány nagyon betegnél sem maradt vissza kimutatható antitest. Az eredeti tanulmány szerint úgy tűnik, hogy az immunválasz minőségével van kapcsolat: az antitestek száma pozitív korrelációban van a C-reaktív fehérjékkel, negatív korrelációban a limfociták számával. Tegyük hozzá, hogy a sok antitest sem biztos, hogy x hónap elteltével is ott lesz, annál, akinél most ott van. Vérplazmás kezeléseknél pedig ezek után nyilván nem közömbös, kinek a vérét használják fel, antitestek nélkül nincs sok értelme az ilyesminek.
  • Miközben António Guterres ENSZ-főtitkár globális tűzszünetre szólított pár hete a járvány miatt, ez nem mindenhol jön össze. Valamelyik frakció épp most vette tüzérségi tűz alá az egyetlen, koronavírusos betegeket kezelő kórházat Líbiában.
  • Németország kelet-európai vendégmunkásokat repít be spárgát szedni és egyéb mezőgazdasági tevékenységre. A román tévé mutatta, micsoda social crowding gyakorlattá fajult az egész a repülőtéren.
  • Indul egy nagy antitest-vizsgálat, random mintavételes, Németországban. Sok mindent megtudhatunk majd belőle: hogy mennyi lehet az aszimptomatikus eset a szimptomatikusakhoz képest, például. És hogy összesen hány százalék eshetett át a betegségen a populációból. Amit nem fogunk megtudni: hogy hányan immunisak és meddig. Sajnos egy rakás politikus és üzletember van, aki pont ezt az utóbbi apróságot nem érti :( A Financial Times pl. leírja, hogy "Establishing how far the virus has spread and how many of those infected died will help authorities decide when they can allow people to return to normal life." Nekik ez fontos.
  • Lesz egyébként többféle mintavétel: egy nagy, n=15000-es (országosan?) kéthetente + az ország legerősebben sújtott részeiből n=2000-esek az ottani populációra koncentrálva. Aztán még egy nagy 15000-es, és az egyértelműen országos. Eredmények májusra az első két vizsgálatból.

2020.04.10.

  • Egy kiváló tanulmány. Wastewater-Based Epidemiology (WBE) is a thing. Kísérlet a fertőzöttség mértékének meghatározására a szennyvízből fellelhető vírusrészecskék alapján Massachusettsben. 
  • Dél-Afrika és Kína után Ruandából is van infóm járványügyi fellépés során történt összeütközésekben elhunyt emberekről — két áldozat, rendőrök lőtték le őket (még márciusban történt az eset). A járvány kapcsán az extra halálesetek száma így 7483+n.

2020.04.11.

Nem szeretek itt a belpolitikával foglalkozni, de olyan kihágás történt kormányzati és kormánypárti részről az elmúlt napokban, hogy ezt nem lehet szó nélkül hagyni. A járvány leküzdése közös ügy. Annak idején előre jeleztem, hogy az sem lenne jó, ha az ellenzék minden tüsszentésért a kormányt tenné felelőssé, viszont azóta látjuk, hogy az "enyhe esetekkel" ("még enyhe", "szerencsére enyhe" stb. esetekkel) a magyar járványügy nem akar foglalkozni tesztelés, kapcsolatkövetés szempontjából. Ez gyakorlatilag azt jelenti (nem tudom, ők értik-e?), hogy lemondanak a járvány megállításáról, mivel a kijárási korlátozás nem akadályozza meg a vírus terjedését önmagában (még szigorúbb formában sem!). A járványt csak komoly felderítő munkával, a fertőzöttek elkülönítésével és a terjedési láncolatok elvágásával lehetne megállítani. Ezek után itt van egy levél is (íme), ahol kormánymegbízotti megbízásra le van írva, hogy még a kórházak és más intézmények közötti transzfereket megelőzően sem hajlandók tesztelni betegeket. Igen, azt jól írják ezekben a levelekben, hogy egy negatív teszt álbiztonságot adhat a fogadó oldalon, de a tesztelés hiánya közben totális felelőtlenségre biztathat a küldő oldalon. Különösen azok után, hogy az elégtelen elkülönítő kapacitás problémáját a fogadó oldalon többször is jelezték (itt és itt). A fogadó oldal felveti egy ponton, hogy a kórházi kapacitások elégtelensége lehet az oka a küldő részéről a sietséggel végzett transzfereknek, küldő oldalról viszont erre nincsen reflexió. A küldő oldal részéről a tesztelésre vonatkozó kérés miatt elkerülendő "fölösleges költségekre" tett utalás ennek fényében különösen ártalmas, hiszen azt jelzi, hogy nem az egészségbiztonság az egyetlen szempont. Hogy ezek után a tetejében megpróbálják a főváros polgármesterének a nyakába varrni a felelősséget az idősotthonokban megjelent fertőzésekért (amik vagy a többek között a tesztelés-kapcsolatkövetés hiánya miatt is szabadon terjedő járvány következményei, vagy konkrétan a betegtranszferekkel kerültek az érintett intézményekbe), és ráállítanak erre egy összehangolt propagandagépezetet, sőt még miniszterelnökileg és a járványügy elvileg szakmai vezetésének elfogult megszólalásával is megtoldják ezt, az különösen súlyosan minősíti a történteket.

  • Más, nem kevésbé fontos: az antitest-vizsgálatok kapcsán a New York Times egy szuper cikke leírja végre a hülyék számára, hogy az, hogy "vanantitestyeneki", nem jelent automatikusan immunitást, pláne nem forevör. Az Ig G (immunoglobulin G) mellett az Ig A-t is nézni kell, mivel nyálkahártyák, így pl. légutak védelmében az fontos szerepet játszik. Plusz nem mindegy ezek szintje, mert lehet belőlük túl kevés. És közben az immunrendszer amúgy is bonyolultabb ennél — az Ig G és az Ig A esetében csak egy aspektusát nézzük az egésznek. A hosszú távú immunitást pedig — megdöbbentő módon — csak hosszú távon fogjuk látni — ha látjuk majd.
  • Kieg. az iméntiekhez: ott van közben a Kínából és a Dél-Koreából jelentett kigyógyult pozitív esetek tisztázatlansága. Erről is jó lenne többet tudni majd. 
  • Utóbbi kérdés azért is fontos, mert Svédországban, Németországban és Ausztriában már vannak random tesztelések (most az USA-ban is következnek majd), és ezekből már levonták a következtetést egyesek, hogy hát akkor a társadalomnak egy egész nagy része "átesett" már ezen (pl. Gangelt kisváros 15%-a). Ha nem volt beteg, akkor nem biztos, hogy átesett. Vanantitestyeneki =/= indestructiblebyfire. Az influenzánál (pont annak relatíve kevésbé súlyos volta miatt) nem nagyon nézegette eddig senki az "antibody-presence-fatality rate-et", mint olyat, ami minőségileg különbözik a "case-fatality rate-től", mint olyantól. Itt egy másik cikk: a már-endemikus humán koronavírusokkal az a tapasztalat, hogy sajnos antitestek mellett is van fertőzhetőség; mint említik, ezt végig is kísérletezték (volt, aki bevállalta a megbetegítést hozzá). Így bizony a vakcina sem biztos, hogy tud hosszú időre védettséget adni majd.
  • Vita a COVID-19-nél jelentkező légzési nehézségek kezeléséről. Korábban említettem olyan olasz orvosi véleményt, miszerint az intubálás prioritás kell, hogy legyen. Most itt van egy egészen más vélemény (a videóban feldolgozott tanulmányban): megkülönböztet L és H fenotípusokat, és arra jut, hogy COVID-19-nél az L a gyakoribb: itt kevesebb a tüdőfolyadék, invazív eljárás nélkül is támogatható a beteg akár, ha nincs súlyosbodás. Ugyanitt szó esik a véralvadás-gátlás lehetséges jelentőségéről is a kezelésben.
  • A hollandoknál is elkezdtek a megfigyelt mortalitásnövekmény és a COVID-19 összefüggéséről töprengeni. Van kb. 2000 extra haláleset olyan április eleji hétről, amikor 881 volt a járvány halottainak hivatalos száma. Ha ezt úgy nézem, némi egyszerűsítéssel (mintha minden koronavírusos haláleset a növekmény része lenne), hogy van akkor +1119, és annak a felét számítom konzervatív saccolással, akkor ez +559. Extra halálesetek globálisan így = +8042+n.
  • Franciaországból adalékok arról, hogy miért bonyolult amúgy ezt számolgatni, hogyan hat pl. erre, hogy jobb vagy rosszabb évhez viszonyítunk, és hogy mikor volt erős a szezonális influenza. A tanulság nem lehet más, pláne Franciaország méretű országok esetében, mint hogy ideális esetben (ha vannak adatok) kisebb területi egységre és korosztály-specifikusan kell nézni, hogy van-e mortalitásnövekmény. A keményebb  (2018. március ellenében végzett) összehasonlítás alapján látszik ez: "additional deaths per 100,000 inhabitants, between March 2020 and March 2018, i.e. 82 in Haut-Rhin, 20 in Seine-Saint-Denis, 18 in Paris, 17 in Hauts-de-Seine and 12 in the Vosges." Ebből populációadatokkal számolva ez jön ki: 82*7,61+20*16,54+17*16,06+12*3,61=624+331+273+43=1271. Ennek a felét számolva +635 adódik az eggyel fentebbi ponthoz (globális extra halálesetek), ami így +8677+n (azért merem így hozzáadni őket, mert más régiókat nem néztünk itt). Ezzel együtt érdemes hangsúlyozni, hogy ez iszonyatosan konzervatív számítás, mert a trendek alapján a 2020-as év a 2019-eshez lett volna hasonló, amíg nem jött a koronavírus, és látványosan eltérítette + nincs annyi autóbaleset.
  • Nem írtam le itt, de nagy a jelentősége: volt végre ENSZ BT-ülés a járványhelyzettel kapcsolatban. Fontos, hogy azért ne együk meg egymást élve, ha egy mód van rá.

2020.04.12.

  • Indiában a kőkeményen konzervatív iszlamista szervezet, a Tablighi Jamaat tömegrendezvénye körül jelentős fertőzési klaszter fejlődött, és egyfelől mondhatnánk, hogy az indiai állam ezek után a dél-koreai megközelítést másolja — ahogyan ott a Shincheonji egyházzal bántak hasonlók nyomán —, másfelől viszont Indiában ez inkább saját megközelítés már régóta.
  • Az Apple és a Google digitális kapcsolatkövető appja. Figyelmeztet, ha kapcsolati hálón és dokumentált, x napon belüli érintkezésen keresztül kitettség merülhet fel. Dél-Koreában, Izraelben pl. már rég használtak ilyesmit ez alatt a járvány alatt, most az USA-ban indul a kísérlet. Adatvédelmi problémák vannak persze, de járványügyileg hasznos lehet.
  • A koronavirus.gov.hu-n közben a tüdőgyulladás és a légzési elégtelenség is megjelentek "alapbetegségként".
  • A USS Theodore Roosevelt fertőzöttjei egy icipicit leterhelik Guam szigetén az ellátást. Japánból át is dobtak már egy tengerészgyalogos szanitéc osztagot. Közben most látom, hogy Thomas B. Modly haditengerészeti államtitkár végül lemondott, beletörött a bicskája abba, ahogyan a Theodore Roosevelt kapitányával bánt.
  • Tragikus és most már elhíresült utolsó szavak intubálás előtt egy betegtől, az USA-ból: "Ki fogja ezt kifizetni...?"
  • A háztartáson belüli erőszak a UK-ben. A kijárási korlátozás alatti beszorulással jött már hír Svájcból és tőlünk is az ezzel kapcslatos kilátásokról, és nyilván sokfelé tapasztalható növekedés ebben az időszakban, ami ráadásul csökkent intézményi cselekvőképességgel párosul.
  • Szlovákiára nem nagyon figyeltem, pedig csak két halottjuk van a hivatalos adatok szerint. Megkapargattam kicsit a dolgot, egyből találtam +1 esetet: "One coronavirus-positive patient has died in Slovakia before, an 84-year-old woman, but the official cause of death was stated as an extensive heart attack." (Globálisan ezzel +8678+n.)
  • Történet Magyarországról. Tanulságok: (1) az egészségügyi dolgozók is lehetnek óvatosabbak social distancing terén (nem ezt volt itt a fertőzés oka, ezt csak by the way láthatjuk a történtekből); (2) diagnosztika terén az elővigyázatossági elvet sértő overconfidence bias megfigyelhető: "nem lehet koronavírus, mert ez csak egyoldali tüdőgyulladás"; (3) képalkotó vizsgálat jellemzően röntgennel történik, ami a CT-hez képest COVID-19 diagnosztizálására finoman szólva nem az igazi; (4) a kapcsolatkövetés itt sem volt körültekintő.
  • Kicsit utánanéztem közben Gangelt városának. Van kb. 12500 ezer lakosa. Ebből 15% szeropozitív egy 500 fős mintán végzett vizsgálat szerint. Ebből vonták le egyesek a következtetést, hogy akkor rengeteg az aszimptomatikus eset, és már csomóan átestek a fertőzésen, akik nem is tudnak róla. Fent már elmeséltem, miért hülyeség ez a feltételezés, és az átesés meg a szerzett immunitás nem úgy működnek, mint egyesek gondolják. De közben gondoljuk meg, ha Gangeltben volt 1400+ eset, értsd: igazi, felbukkant, felderített eset, akkor a 15% nem is olyan sokkal több. Kb. +400 embernél feltételezhető ezek szerint antitest jelenléte az azonosított "eseteken" felül. Valamennyi antitesté, amennyi nem biztos, hogy egy alaposan körbeköhögött bevásárlásnál is elég.
  • A maffia építi társadalmi bázisát, rászoruló pedig akad bőven (Olaszország).
  • Ez a kutatócsoport most 80%-os valószínűséggel ígér őszre működő vakcinát a koronavírus ellen, mai hírekben hallottam. Csimpánz-adenovírust használnak, az ezzel való beoltásnak a MERS-CoV elleni hatásosságáról volt már adat korábbról. Vektorként más oltásoknál is használják. Persze a vakcinát gyártani is kell majd még.

2020.04.13.

  • Hazaküldik a krónikus belgyógyászati betegeket a Jahn Ferenc kórházból. Ha minden igaz, ennek a hátterében az van, hogy "a fekvőbetegeket fogadó összes hazai gyógyító intézményben a közfinanszírozott ágyak minimum 60 százalékát alkalmassá kell tenni az új koronavírussal fertőzöttek ellátására, és ezt az intézkedést húsvét alatt kell végrehajtaniuk a kórházaknak."
  • A Kreml szerint kezd súlyossá válni a helyzet a moszkvai kórházakban.
  • A maszkviselés hasznosságáról friss tanulmány. Fontos kiegészítés lehet, hogy az, hogy "Our results indicate that surgical face masks could prevent transmission of human coronaviruses and influenza viruses from symptomatic individuals", az egyben azt is jelenti, hogy az aszimptomatikusaknál is, plánesőt.
  • Támadás karddal kijárási korlátozást kikényszerítő rendőrök ellen Indiában.
  • Hosszú tud lenni a felépülés a COVID-19-ből, és sajnos gyakran nem lineáris.
  • Etikus-e deportálni embereket egy járvány sújtotta országból egy gyenge eü. kapacitásokkal rendelkező másikba, bármilyen okból is történjen ez? USA-Haiti viszonylat.
  • Egy New York-i tanulmány. Amit feldolgoz: "4,103 patients with laboratory-confirmed Covid-19 disease in New York City, of whom 1,999 required hospital admission and 650 required intensive care, mechanical ventilation, were discharged to hospice and/or died." Kritikus jelentőségű kezelés szempontjából: "Clinicians should consider routinely obtaining inflammatory markers during hospitalizations for Covid-19" (=gyulladásmarkereket nézni rendszeresen). Életkor 65 felett, 40 feletti testtömegindex jelentős kockázat (Body Mass Index, BMI; számítása: kg/m2-ben, azaz pl. 80 kg / 1,79x1,79 m2). 200 feletti C-reaktív fehérje is. A tanulmány végén döntési fák! A hospitalizációs kockázat/szükséglet felmérésénél a fehér/nem-fehér ismérv alapján is különbséget találtak (nem-fehérek kilátása rosszabb). További érdekesség az elvileg bakteriális fertőzés okozta gyulladás kapcsán emelkedő prokalcitoninszint kockázatindikatív volta, anélkül, hogy az ténylegesen bakteriális felülfertőzéshez látszana kapcsolódni az itt vizsgált eseteknél. (H/t Epikurosz, ismét.)
  • Ugyancsak a kommentek közül kiemelve: republikánusok (pontosabban konkrétan a Trump-támogatók) csinálják a social distancinget kevésbé. Emellett az alacsony jövedelmi csoportra is kijön ez. A módszer, ami alapján a kutatók erre a következtetésre jutottak, a mobilhasználók által megtett napi távolságok változásának mérése volt egy járvány előtti referenciahét értékeihez képest.
  • A kommenteket mindig érdemes nézni, mert nagyon sok hasznos dolog van ott is!

2020.04.14.

  • Nagyon kellemetlen olvasmány. Ezt persze majd sokat kell még vizsgálni, és nyilván meg kell figyelni, mi történik a felgyógyultakkal hosszú távon, de sajnos a COVID-19-eseknél gyakran látható limfopéniából (limfocitopénia, limfocita-hiány; CD-3-as, CD-4-es és CD-8-as T-sejtek csökkenése) vagy például a sokaknál lassú, visszaesésekkel tűzdelt felépülésből érezhető volt, hogy valami ilyesmi is lehet a hátterében. Majd részletezem ezt, ha már biztosabbat lehet tudni, de úgy tűnik, hogy a SARS-CoV-2 S-fehérjéjének valamely doménje a T-sejtekbe is lehetővé teszi a behatolást (talán a CD147-es receptoron át), és ezzel a vírus közvetlen romboló hatást fejt ki az immunrendszerre. Ami ebből következik, az az, hogy rendkívüli költségek vállalása indokolt a járvány felszámolása érdekében. Ha pl. valaki elgondolkodna, hogy "érdemes-e", "nem pazarlás-e" letesztelni valakit, aki kitett lehet, tessék szabadságra küldeni. Ez annyira fontos, hogy ma már nem is írok ide mást, holnap pedig új bejegyzést nyitok. Közben erről a cikkről a Nature-ből lemaradtam, az eredeti forrás az itt tárgyalt témában, úgyhogy pótolom. Ebből úgy tűnik, hogy a T-sejtekben legalább nem replikálódik tovább a SARS-CoV-2 (ellentétben a HIV-vírussal).
  • És még egy adalék: ennek a magyar férfinak a tapasztalatai is figyelemre méltók. Én értem, hogy erőforrás-szűkösség van, de azért hogy állandóan összeköttetéseket kell mozgósítaniuk meg a betegségüket huszonötször bizonygatniuk beteg embereknek ahhoz, hogy foglalkozzanak velük, vagyis hogy a verbális vesszőfutásra való készség és a belépő társadalmi tőke (pl. orvos ismerősök megléte) gyakorlatilag szűrő diagnosztikai kritériumok, ez nagyon nincs rendjén, akármi is a végső ok, vagy akárki is a végső felelős ezért.

Folyt. köv. A folytatás itt olvasható, új bejegyzésben

19 komment

A koronavírus-járvány további alakulása

2020.03.22. 09:30 :: Marton Péter

Na jó, inkább folytatom, de ide, egy külön posztban, és sokkal lazábban, mert tényleg nem lesz annyi időm, mint eddig.

Előzmények:

2020.03.22.

  • Egy remek grafikont érdemes megnézni az alábbi cikkben arról, hány regisztrált eset volt adott országokban akkor, amikor a halálozások száma elérte a négyet. Norvégiában 1500+, Svédországban 1000+, Belgiumban 629, Kanadában 424, Indiában 191... Magyarországon 85. Felderítési teljesítmény.
  • A sajtószabadság és a millió főre jutó felderített esetek száma közötti összefüggés... negatív korreláció. Amiből nagyon fura következtetés adódhatna, miszerint a sajtószabadság hiánya jó. Viszont ha pl. népességarányosan egyenletes járványeloszlást feltételezünk, akkor a sajtószabadság hiánya vagy relatív gyengesége mindjárt rossznak mutatkozik ugyenezen adatok alapján. Az tuti, hogy érdekes az orosz, belarusz, azeri és török esetek alacsony népességarányos száma.
  • A CNN-en megdöbbentő dolgok. Idézem: "As the coronavirus pandemic grows and more states order residents to stay home, officials are making a tough choice to only test high-risk patients and those who are severely ill. (...) The focus has shifted to avoiding broad testing to conserve rapidly dwindling resources such as masks, ventilators and intensive care beds." Többek között New Yorkban és Kaliforniában. Miért katasztrofálisan rossz ez? Mert ez a gombhoz varrott kabát esete. Fordítva ülés a lovon. Ha valaki ARDS-el esik be egy melegebb márciusi-áprilisi napon, azt ugye nem gondolják, hogy a jelen kontextusban egészen komolyan tesztelni a legfontosabb? Pont az enyhe eseteket érdemes tesztelni, ahol sokkal hatékonyabban vethetők be az antivirális szerek a megfelelő diagnózis birtokában, az érintettek állapotánák súlyosbodását megelőzendő, és ahol differenciáldiagnózis tekintetében a PCR-tesztnek sokkal nagyobb értéke van. Az pedig vérlázító gondolat, hogy azért ne teszteljünk, mert akkor az intenzív osztályra nem kell annyi embert felvennünk. Ez illogikus, immorális és káros egyszerre.
  • Az aeroszolizáció nem jelentős kockázatára utaló eredmények a CDC-től ebben a tanulmányban, tíz beutazott COVID-19-es páciens kontaktvizsgálata alapján. A lényeg: "a symptomatic secondary attack rate of 0.45% (95% confidence interval [CI] = 0.12%–1.6%) among all close contacts, and a symptomatic secondary attack rate of 10.5% (95% CI = 2.9%–31.4%) among household members". Ami gyengíti az eredményt: mindössze 19 egy háztartáson belül élő kontaktból került ki a 10,5%-os attack rate. Ezzel együtt ez a szoros kontakt jelentőségét erősítő eredmény. Ez pedig azt jelenti, hogy a járványt fel kell számolni, mert erre van esély.
  • Boris Johnson brit miniszterelnök főtanácsadója, Dominic Cummings állítólag a következőkkel sommázott egy prezentációt a kormányzat járványügyi stratégiájáról egy privát körben tartott találkozón: "Nyájimmunitás, megvédjük a gazdaságot, és ha pár nyugdíjas meghal, annyi baj legyen". Ez még akkoriban volt, amikor Patrick Vallance kormányzati tudományos főtanácsadó nyomatta őrült ötletét a populáció élővírusos átoltásáról.
  • Az alacsony német halálozásról. A tesztelés volna a magyarázat — és az enyhe esetek gyors felderítése? 160 ezer tesztet tudnak csinálni hetente, úgyhogy ez komoly fegyvertény.

2020.03.23.

Ez a magyar törvényjavaslat nagyon nincs rendben. A koronavírus elleni védekezés miatt nem szabad a parlamentet csak úgy félreállítani semmilyen körülmények között. Egy parlament is tud online működni, ha erre megfelelően felkészülnek, nem megoldhatatlan dolog. Sem a francia, sem a spanyol, sem az amerikai esetben nem látunk jelenleg olyat, hogy a törvényhozást valaki teljesen meg akarná kerülni. Legalább a rendkívüli állapot meghosszabbításáról döntenie kell a törvényhozásnak bizonyos limitált idő elteltével. Nincsenek időben végtelen különleges jogosítványok.

Ha nagyon jóhiszeműen próbálom nézni a magyar törvényjavaslatot, valami olyasmit látok, hogy a kormány egyszerű, gazdaságos hatalomgyakorlást akar. Végül is a parlament reálisan amúgy sem képez ellensúlyt Magyarországon már egy ideje (ami elég rossz érv demokratikus nézőpontból, de tény kérdése). De gondoljanak bele, mi lesz, ha a tisztelt vezetőséget is eléri a járvány, mert előbb-utóbb el tudja érni. Ha kiesnek kulcsemberek, és ismeretlen újak törnek előre, az mit jelent majd a közbizalom szempontjából? És egyáltalán, ténylegesen mennyire lesznek megbízhatók azok a most még ismeretlen emberek?

Egy ilyen napon ezzel az olvasmánnyal érdemes folytatni Yuval Noah Hararitól. Nagyon jó kis kérdéseket vet fel, és — még inkább — nagyon fontos felszólításokat tesz. 

  • 26 éves koronavírusos beteg (nő) beszámolója. Kórházba került, intubálni kellett. A másik kórteremben egy 30 éves is volt ott. Kieg.: mint ebből a cikkből kiderül, a 26 éves hölgy egyébként Lyme-kóros és amellett autoimmun beteg, de mielőtt valaki levonja a következtetést, hogy ja, akkor ő nála érthető, más pedig nincs kitéve kockázatnak: "Twenty percent of those hospitalized with the virus, according to the CDC, were between 20 and 44 years old."
  • Hongkong. A túl korán véget érő social distancing tanulságai, Hongkongba külföldről visszatérő fertőzöttekkel súlyosbítva. Az emberek felszabadult összejöveteleket tartottak, és tömött metrón vetették magukat munkába. 
  • Ezt már korábban akartam linkelni. Arról, hogy tesztelni azért nem olyan borzasztóan nehéz.
  • Vakcinafejlesztés Kínában. Gyorsan találnak önkénteseket. Láthatóan eltökéltek, hogy a lehető leghamarabb eredményeket produkáljanak.
  • Az van, hogy ez a járvány nem idővel, hanem azonnal megzavarja a krónikus betegek ellátását. Ebben a cikkben a kemoterápiák és a dialízises kezelések komplikációiról lehet olvasni.
  • Extrém dolgok Finnországból. Játszóteret rongáló tinédzserek és gyalogoszónában parkolásból a boltba rohanó sportautós figura.
  • Egyesek egy fordulat szükségességét feszegetik. Már előre tartottam tőlük, mert sejtettem, hogy előbújnak majd egy sarokból előbb-utóbb. Elég törvényszerű a dolog. Végül kicsit hamarabb megteszik, mint gondoltam. A Politico.eu cikke pofátlanul mindenki nevében írja, hogy most már "látjuk", hogy az élet leállása nem tartható fenn sokáig (egy hét után, komolyan? Erről az a South Park rész jut eszembe, ahol a síházban rekedő emberek öt perc után felvetik, hogy meg kell enniük egymás lábát). Közben Trump is erről tweetelget. Ha engem kérdeznek: ennek a járványnak a felszámolását nem lehet megkerülni, megspórolni. Különben a gazdaságot kiteríti így is, úgy is. A járvány felszámolását EL KELL VÉGEZNI. Ha ennek nem állunk neki egészen komolyan, a végtelenségig tényleg nem állhat le a gazdaság, de utána brutálisan rossz hatások következhetnek. Kell 3-6 hét tényleg határozott felderítő jellegű tesztelés és kapcsolatkövetés a szálak elvarrásával, utána lehet csak enyhítéseken gondolkodni, amik alatt viszont folytatódnia kell keményen a tesztelésnek és a kapcsolatkövetésnek még hónapokig. Ezt meg lehet csinálni — az alternatíva pedig csak nagyon rossz lehet

2020.03.24.

Nyomatékosítandó a tegnapiakat (a vastag betűvel szedett részt), itt van Bruce Aylward a WHO-tól, és hogy ő hogyan látja a helyzetet. Mivel az alábbiakból minden szóval egyetértek, vastag betűvel és keretbe szedem az alábbiakat:

"the big question right now is “Are countries going to use this time during these shutdown periods optimally?” Because if you just shut down your societies, your economies and hope for the best… This is guerrilla warfare against a virus, the virus is just going to sit you out, it’ll just circulate quietly among households and then you’re going to let them all go again and phoom there’s no reason it shouldn’t take off again, unless you’re ready for it."

  • Ha valakinek hiányzik két lépés távolság a témától, itt ez a cikk, ezt kell olvasni. Vírusok nélkül nem lennének emlősök, és akkor, ahogy Jason Bourne mondaná, we wouldn't be having this conversation.
  • Az olimpia elhalasztva.
  • A brit NHS kapacitásválság elé néz nagyon hamar. Felkészülhetnek a szükségkórházak.
  • Ahogyan egy New Jersey-i olasz-amerikai famíliánál is egy családi összejövetel bizonyult végzetesnek, ebben a connecticuti esetben egy baráti összeugrás vezetett a résztvevők 50%-ának és rajtuk keresztül még sokaknak másoknak a megfertőzéséhez. Nyilván volt az elején puszi-puszi, pár ölelés is a messzi Dél-Afrikából beesetteknek, aztán együtt csipegettek falatkákból, használták egymás után a vécét stb.
  • Globális halálozás: 18571+1693=20264. Felső érték = 20264+n. A március 9-i halálozás tíz nap alatt duplázódott. Azóta hat nap telt el, és majdnem újra duplázódás tanúi vagyunk a nap végére megtörtént az újabb duplázódás. Így néz ki az exponenciális növekedés. 

2020.03.25.

  • Az okos hőmérőkből gyűjtött adatok alapján a Kinsa nevű cég remekül tudja jelezni, hol fordul elő atipikusan sok lázas állapot a szezonális átlagokhoz képest (jelenleg a háttérzaj szintjét a kivonulóban élvő influenzaszezon határozza meg). Azt is látják, hogy ahol az emberek mostanában sokat lófrálnak az utcán, az adatok növekedést mutatnak a megbetegedéseket tekintve, ha pedig bevezetnek korlátozásokat valahol, az lejjebb viszi az ilyesmit.
  • Ezt a linket most Roger Seheult pulmonológus videójából vettem, ahol a doki végigfuttat egy nagyon jó gondolatmenetet az egészségügyi kapacitástervezésről és -menedzselésről. A "flattening the curve" helyett én úgy mondanám, hogy itt a "tunneling the herd" feltételeiről beszél. A social distancing és a felderített esetek elkülönítése csökkenti az alagúton átküldendő kocsi magasságát, az egészségügyben a korai kezelés, a PPE-k alkalmazása és egyebek pedig magasítják az alagutat. Ugyanebben a videóban hangzik el, hogy (1) a lassan már elérhetővé váló antitest-vizsgálatok segíthetnek aszimptomatikusan átesetteket azonosítani és újra biztonságosan munkába állítani; (2) a BCG-vakcina bírhat némi megelőző, immunerősítő hatással virális fertőzések, vagyis akkor talán a SARS-CoV-2 ellen is, és ez fontos szerepet játszhat például az idősek és a krónikusan betegek védelmében.
  • Bangladesben kikerült egy dokumentum a BRAC (Bangladeshi Rural Advancement Committee) civil és segélyszervezet köreiből (a BRAC Egyetemről) arról, hogy ott mennyi halottra és hospitalizációra számítanak, alapvetően konzervatívan számolt arányok mellett. Ennél ténylegesen nagyobb számok is kijöhetnek, ha tényleg 81%-os átfertőződéssel megy végig rajtuk a járvány (ami persze elég kemény feltételezés), ha pl. a sok százezer ott lévő, nem túl jó körülmények között élő rohingja menekültre gondolunk (Mianmarból). 

ADATOK ebben a cikkben. Megyei bontásban Kaliforniából, a regisztrált esetek korosztályonkénti megoszlásáról.

LA County

0-17: 10
18-40: 268
41-65: 250
65+: 107

Orange County

0-17: 1
18-49: 87
50-64: 41
65+ 23

Mit mutat ez? Azt nem, hogy a 0-17 éves korosztályban nincs fertőzöttség. Csak azt, hogy onnét kevesebben lesznek regisztrált esetek, vagyis a legvalószínűbb, hogy enyhék a tüneteik vagy nincsenek, és nem kerülnek tesztelésre. A 18-49 éves korosztály érintettsége viszont nagyon is jelentős, az idősebbek éppenséggel kisebb arányban szerepelnek ezekben a tesztelt populációkban. Szóval, mint korábban már jeleztem: a teszteléssel különösen az enyhe esetek azonosítása fontos cél, a fiatalabbak között, hogy a populáció e mobilis tagjainak a megfelelő elkülönítésével és kezelésével megelőzhető legyen a járvány robbanásszerű terjedése.

  • Más. Ismét találkoztam az érvvel, miszerint a teszteléssel PPE-ket (orvosi védőfelszerléseket) használunk el, és emiatt is kevesebbet kellhet tesztelni. Azért ez nem lenne megoldhatatlan probléma. Kicsit át kellene gondolni a protokollokat, és akkor menne máshogyan is. Pl. jól jöhetne egy plexifal egy lyukkal a tesztelt személy és a mintát vevő személy közé. És hasonlók.
  • Szuper cikk a PCR-tesztekről. Legfőképpen ezt a részletet ragadnám ki belőle, egy stratégiait: "a test that works in one country might not work in another, said Rawlinson. If, hypothetically, the presence of dengue fever caused a test not to work, and a country had a large rate of dengue fever, then there might be a high rate of false negative, he said." De egyebek is vannak itt: döbbenet, hogy miközben Olfert Landt SARS-tesztje január 17-től ismerten működőképes volt (és aztán pénzért elérhető lett 173USD/db áron), a hongkongi Leo Poon ingyen osztogatott SARS-CoV-2-specifikus (az új koronavírus genomszekvenálását követően készített) tesztkészletei pedig eljutottak számos országba kb. ugyanakkortájttól ingyenesen, ennyi időt elpazarolt számos ország a felkészüléssel :(
  • Nagyon jó cikk a HVG-től a kínai orvosi szállítmányokról. Van mögöttük üzleti érdek és még egyszerű viszonzása is korábban éppen Kínába küldött hasonló szállításoknak (pl. az olasz esetben, ahol a kínai média ebből hatalmas propagandát is csinált). Más esetekben láttuk, hogy még fizetős szállítást is segélynek vélnek egyesek tévesen. A többek között a Krímmel kapcsolatos szankciók fellazítására irányuló orosz akció pedig nagyon csúnyán besülhet most, hogy Oroszországban is van már 500 felderített eset, és Itáliába küldtek egy rakás értékes felszerelést és kiváló szakembereket.
  • Újabb magyar járványtérkép OSINT alapon, a Válasz Online-tól! 
  • A Zhejiang Egyetem klinikájától kézikönyv a COVID-19 egészségügyi intézményekben történő megelőzéséhez, diagnosztizálásához, kezeléséhez, all in. Magyar fordításban! Kitüntetést mindenkinek, aki ebben részt vett.
  • Hogy pár dolgot kiemeljek a kézikönyvből: (1) plazma légtisztítók használata az érintett belterekben + UV-besugárzás alkalmazása is, egyebek mellett; (2) a betegek székletét, vizeletét hazmatként kell kezelni, gyűjteni, fertőtleníteni; (3) a lélegeztetőgépek különböző alkatrészeinek megfelelő fertőtlenítés; (4) tápláló étrend az egészségügyi személyzetnek (talán nem eretnek gondolat, ha hozzáteszem, hogy "és a betegeknek is"); (5) az eddig általam olvasott tanulmányokban alábecsülhették, milyen gyakran mutatható ki a vírus székletből: "Azon betegek, akiknél a légúti mintavétel nukleinsav pozitivitást igazolt, kb. 30-40%-nál vér-ből és 50-60%-nál székletből is kimutatható volt a virális nukleinsav"; (6) CT vs. röntgen: "A HRCT (magas felbontású CT) rendkívül előnyös, míg a hordozható mellkasröntgenek az immobilis kritikus álla-potú betegek számára jelenthetnek segítséget"; (7) terminológia: az "üverőrlemény homályfoltokat" itt "tejüveg homályfoltként" említik.
  • Különösen fontos továbbá: "A korai diagnózis, a kezelés és az elkülönítés elvégzésére minden adandó alkalommal törekedni kell. A tüdőben zajló folyamatok képalkotó eljárásokkal történő rendszeres vizsgálata, az oxigén-ellátottság és a citokin-szintek dinamikus monitorozása segíti azon betegek korai azonosítását, akiknél a betegség súlyossá vagy kritikussá válhat. COVID-19 fertőzés diagnózis felállításának gold standardja a SARS-CoV-2 nukleinsav pozitív eredménye. Azonban figyelembe kell venni azt is, hogy a nukleinsav kimutatáskor álnegatív eredmény is születhet, így a feltételezett esetek a CT vizsgálatok során leírt jellegzetes elváltozások miatt megerősített esetekként kezelhetők akkor is, ha a nukleinsav teszt negatív."
  • Más: a kínai vezetés a jelek szerint aggódik, hogy a helyi pártvezetők esetleg elhallgatnak egy újabb kitörést, ha úgy alakul. Pontosan tudják, mennyit fektettek abba, hogy elérjék a jelenlegi állapotot, én is aggódnék a helyükben.
  • Magyarországon a 37 éves brit nagykövet-helyettes a tizedik, akarom mondani tizenegyedik áldozat (a +1 esettel, amikor egy fertőzött beteg édesanyja hunyt el vírusos tüdőgyulladásban). R.I.P.
  • Romániában e szerint a cikk szerint 103 egészségügyben dolgozó személy fertőződött meg eddig.
  • Review előtti tanulmány, de nagyon fontos: úgy tűnik, hogy a SARS-CoV-2 ellen rézuszmajmoknál kialakult tartós szerzett immunitás, SARS-CoV-2-specifikus immunoglobulin G jelenléte alapján. Négy majommal végezték a kísérleti újrafertőzést, közben PCR-teszttel és antitest-teszttel is kísérve a történéseket. Persze a "tartósság" jelentése ezen a ponton bizonytalan, ezt is látni kell: 28 nap után ott volt az IgG, de aztán meddig lesz ott — pár hónapig, évekig, vagy egy életre? Nem mindegy. Már sok szakkönyvi és egyéb hivatkozást közzétettem erre vonatkozóan, de itt egy újabb jó cikk, ahol írják: "When people are infected by the milder human coronaviruses that cause cold-like symptoms, they remain immune for less than a year."

2020.03.26.

  • Romániában kifejezetten szűrésjelleggel le akarnak mindenkit tesztelni előbb Bukarestben, aztán más városokban. Első hallásra nem tűnik igazán praktikus intézkedésnek, mivel sok lehet a fals negatív a még éppen csak megfertőződötteknél, és végigvizsgálni egy ekkora népességet nem 5 percet vesz igénybe. Ajtóról ajtóra járni maga is hordoz némi egészségügyi kockázatot, és nem mindegy, sikerül-e megfelelően számon tartani például, hogy melyik minta kihez tartozik — egy-két adminisztratív tévedés mindig benne lehet a pakliban ilyen számok mellett. Antitest-teszttel kombinálva ráadásul többre mennének, mert azt is tudnák, hányan estek már át a fertőzésen, hogy rendelkezzenek valamennyi szerzett immunitással.
  • Egy fontos cikk, 24.hu. A lélegeztetőgépekkel kapcsolatos emberimunka-igény és technikai feltételek. Nagyon jó, ha érkeznek újabb eszközök, de nem mindegy, hogy alkalmazhatók-e. Hogyan kapják az oxigént, csatlakoztathatók-e a meglévő kórházi elosztó infrastruktúrához, sikerül-e a piacról szerezni átalakítót, ha nem, kell-e palackokkal dolgozni, és azokat rendszeresen cserélgetni, lesz-e elég ember, aki kezeli a gépeket, altatja szükség szerint a betegeket, fertőtlenít, takarít, pszichológiai támogatást ad, egy orvosra hány beteg jut az intenzív osztályon stb.
  • Bergamói kórházi tapasztalatokból: "Ma már úgy látják, valamennyi felsőlégúti tünetet produkáló embert (és az újabb eredmények alapján az emésztőrendszeri fertőzéses tünetekkel jelentkezőket is) azonnal izolálni kellett volna, és úgy kellett volna kezelni, mint ha fertőzöttek lennének. Ha mégsem azok, akkor scusi. Senki sem lesz boldogtalan, ha arról értesítik, hogy nem kapta el a vírust."
  • A "koronavírus-kihívás" elmebeteg művelőiből nem túl meglepő módon kerülnek ki aztán fertőzöttek is, pl. WC-csésze nyalogatása után. Ezt önmagában nem bánnám, ha mindez a saját testükről való szabad rendelkezés szellemében történne, mások ugyanerre vonatkozó jogának csorbítása nélkül, csak hát sajnos ezek az idióták (görög szó, eredeti jelentése lényegében: magánszemély) a szüleikre, nagyszüleikre, krónikusan beteg (és erről vagy tudomással bíró, vagy mit sem sejtő) barátaikra és számukra ismeretlen emberekre is veszélyt jelentenek. Pláne ha esetleg már az előtt fertőzöttek, hogy elkezdenek végignyalogatni mások által is érintett tárgyakat. (Egy pillanatra eljátszottam a gondolattal, hogy az ilyen fenegyerekeknek javasolható, hogy kórházi önkénteskedéssel kísértsék inkább a sorsot, mert oda pont vagány fiatalokat keresnek, de az a helyzet, hogy ennyire korlátolt emberek oda nem valók.
  • Az emberekből a legrosszabb is kijön ilyenkor. Ez a belga nővér névtelen fenyegetéseket kap, mert valaki aggódik, hogy a házban, ahol lakik, mások miatta kaphatják el a betegséget. Kezelést adott esetben azért nyilván szeretnének. 
  • Idlib és környéke. Szíria utolsó felkelők ellenőrizte darabkája, 100 lélegeztetőgéppel, 10 ezer emberre 1,4 orvossal, 200 intenzív ággyal, néhány száz SARS-CoV-2 tesztkészlettel.
  • Úgy tűnik, az Egyesült Királyság nem óhajt részt venni az EU-s országokkal közös felszerelés-beszerzésben (PPE-k, lélegeztetők, egyebek beszerzésében; Joint European Procurement Initiative), amire pedig adott volt a lehetőség. Mármint az NHS-ben dolgozó orvosok persze nem ezt akarnák, de Boris Johnsonék. Pont.
  • Közben egy 36 éves ápolónő került éppen intenzív osztályra, gyorsan romló állapotban, Nagy-Britanniában.
  • Idehaza. Komoly élelmiszerár-infláció kis, félreeső településeken.
  • A minap beszélgetésbe keveredtem néhány, érveket a kelleténél nagyobb magabiztossággal osztogató emberrel, akik nem akarták megérteni, miért nem elég jó alap közegészségügyi politikacsinálás területén egy random mintán megnézni, hogy hány ember vérében van antitest SARS-CoV-2 ellen, és az alapján nyájimmunitást hirdetni, majd mindenkit (pl. 55 év alatt) munkába küldeni. Túl azon, hogy egyelőre nem jellemző, hogy egész országok lennének egyenletesen terítve a fertőzés által, és ezért egyes térségeket komolyan sújtana egy ilyen politika, tekintettel a térségenként eltérő átfertőzöttségre, és túl azon, hogy ezt tenni felesleges lehet, ha netalántán komolyan megpróbálnánk felszámolni a járványt, kellően széles körű teszteléssel, kapcsolatkövetéssel és elkülönítésekkel, és netalántán ez még sikerülne is mondjuk, ahogy a világon néhány helyen már sikerült, még az egyéni kockázatok is jelentősen eltérnek. Az pedig nem fair, hogy embereket orosz rulettezni küldjünk az utcára. Az egyéni, otthoni tesztelés antitestekre (és azzal együtt a szerzett immunitásra) sokkal intelligensebb megoldás lehet, ha egyszer megbízhatóan működni fog. Persze a gazdaság nagy tábornokai, akik szívesen megspórolnának két fillért is a társadalom rovására, míg ők azért magánklinikákra járnak, személyi orvost alkalmaznak, és magányachtkora is lélegeztetőgépet telepítenének, hát, nekik persze ez nem feltétlenül elég jó. Remélem, nem az ő véleményük számít majd.
  • Kína megtiltja külföldiek beutazását az elmúlt napok rengeteg importált esete után — ezek egyébként nagyrészt hazatérő kínaiak voltak, de azért meg tudom érteni még így is.
  • Etiópia 12 regisztrált eset mellett inkább szabadon ereszt 4000 elítélt börtönfoglyot. India 722 eset mellett is rendkívül komoly zavart keltő országos korlátozások mellett döntött. Ezek az országok valószínűleg jól érzik, mennyire elégtelenek a kapacitásaik a probléma nyomon követésére, és ezért is próbálnak ennyire korán és ennyire nagyot lépni.

2020.03.27.

  • Szenzációsan jó cikk egy onkológustól arról, hogy a toxikológiában alapvető dózis-válasz kapcsolat hogyan működhet a vírusok esetében, és milyen bizonyítékok szólnak amellett, hogy a transzmisszióval vagy esetleg ismételt transzmissziós incidensekkel kapott dózis(ok) alakulása befolyásolja a betegség várható súlyosságát. Alapvető implikációk adódnak a frontvonalban dolgozó egészségügyi személyzet rotálásának szükségességétől a gyógyszertesztelés folyamatán keresztül a hétköznapi életben tartott higiénia fontosságának megerősítéséig.
  • Svájcban a hatóságok azzal számolnak, hogy a korlátozások folytatódásával az összezárt családokban több lesz majd a családon belüli erőszak, és ez megfelelő intézményi áldozatsegítést kíván — "ahogyan az ünnepek idején is lenni szokott" :(
  • Egy cikk, melynek alapján érdekes dolgokat kezdek gondolni Japánról. Az van benne kifejtve, hogy tulajdonképpen a hatóságok itt részben figyelmen kívül hagyják a járványt, és hogy ez tök jól van így, mert ők nagyon jól kezelik a random beeső tüdőgyulladásos eseteket. Tán még az orvosaik sem fertőződnek meg...? Tán nem telnek be a kórházaik, ahogy már a Diamond Princess utasaitól is megtelt anno az egyik kórházuk...? Feljegyzem, hogy ha az, ami ebben a cikkben le van írva, igaz, akkor Japánban csúnya idők jönnek. Azért még kételkedem a cikkben egy kicsit.
  • Az Egyesült Államokban már több megerősített eset van, mint Kínában volt eddig összesen. Ezzel világelsők — természetesen ebben a jelentősen felpörgetett tesztelésnek szerepe van, de halálozásban is csúnyán állnak, bőven 1000 felett.
  • Wuhanban már oldják a korlátozásokat. Azért a napokban volt még új esetük, egy orvos, úgyhogy a vírus egyelőre ott kering, de jóval kisebb számú eset mellett. Ha ezeket levadásszák, van esélyük a szálak elvarrására.
  • Beszélgetés arról, hogy mit jelent a COVID-19-válság a humanitárius válaszadás területén, pl. IDP- és menekülttáborokban. Sok érdekes kérdés felvetődik, egyet ragadnék meg: Van-e low-tech alternatívája a gépi lélegeztetésnek?
  • Boris Johnson fertőzött. Dötéshozatali szempontból érdekes kérdés lehet, hogyan hat egy esetlegesen felgyógyult vezető döntéshozatalára, hogy átesett (és hogy hogyan esett át) a fertőzésen?
  • 16 éves lány halála Franciaországban. Itt lehet elolvasni franciául is, hosszabban. Alattomosan romlott az állapota, mint azt már nem egy esetben láttuk.
  • 17 éves fiú halála az Egyesült Államokban. Nem volt biztosítása, nem kezelték, csak amikor már nagyon súlyos állapotban volt. Ez így még csak nem is regisztrált eset, hanem egy újabb +1, amilyenből eddig is volt már egypár a világban.
  • Iránból olyan történetek jönnek, miszerint tömegesen próbáltak emberek sajnálatos módon metilalkohollal szennyezett alkohol fogyasztásával védekezni a koronavírus ellen. Az eredmény különböző források szerint 300 vagy 480 halott. Hogy aztán ez most komolyan a metilalkohol miatt van-e, vagy egy olyan történet, mely a népre hárítaná a felelősséget a járványnak a hivatalosnál vélhetően sokkal több áldozatáért, nem tudom. Mindenesetre +390-et ezzel a halálozási adatokhoz számítok alább, ahol az addicionális halálozást is követem. Metilalkohol-mérgezés egyébként Iránban gyakran előfordul általában is.
  • Globális halálozás: 26939+2084=29023. Felső érték = 29023+n.

2020.03.28.

  • Relatív kockázatok alakulása vércsoportonként. Review előtti paper. Már a SARS-nál is voltak eredmények a 0-s vércsoport kisebb kockázatáról. Itt az eredmények így néznek ki fertőzésre fogékonyságot tekintve: "The ABO blood group in 3,694 normal people in Wuhan displayed a percentage distribution of 32.16%, 24.90%, 9.10% and 33.84% for A, B, AB and O, respectively, while the 1,775 patients with COVID-19 from Wuhan Jinyintan Hospital showed an ABO distribution of 37.75%, 26.42%, 10.03% and 25.80% for A, B, AB and O, respectively. The proportion of blood group A in patients with COVID-19 was significantly higher than that in normal people, being 37.75% in the former vs 32.16% in the later (P < 0.001). The proportion of blood group O in patients with COVID-19 was significantly lower than that in normal people, being 25.80% in the former vs 33.84% in the later (P < 0.001, Table 1). These results corresponded to a significantly increased risk of blood group A for COVID-19 with an OR of 1.279 (95% CI 1.136~1.440) and decreased risk of blood group O for COVID-19 with an OR of 0.680 (95% CI 0.599~0.771, Table 1) in comparison with non-A groups and non-O groups, respectively." A halálozási kockázat is hasonlóan alakult. Persze itt egy helyben "normálisnak" mondható vércsoporteloszláshoz viszonyították a fertőzések arányát, és az eloszlások más országban-társadalomban eltérőek lehetnek.
  • A kínai CDC vezetője, Georga Gao interjút adott a Science-nek. Üzenetek: 1) tessék maszkot viselni; 2) tessék minden esetet megkeresni és elkülöníteni; 3) tessék testhőt mérni közterületeken sokszor, sokfelé, a lázas embereket ki kell szűrni; 4) lehet, hogy volt sok aszimptomatikus eset, de annyi nem, hogy akár Kínában nyájimmunitásról lehessen beszélni — majd jönnek az antitest-tesztek, hogy tisztábban lássunk, mennyien eshettek át a fertőzésen; 5) a Remdesivirről lesznek RCT (randomised control trial) eredmények áprilisban.
  • Nagyon rossz állapotok egy New York-i kórházban. Mint az ott beszélő orvosnő elmondja, rotálják és újra viselik + egész nap hordják az N95-ös maszkokat. További súlyos dolgok: autóbalesetből behozott embereknél találnak a CT-vel váratlanul koronavírus-fertőzésre utaló elváltozásokat a tüdőben. Másik figyelemre méltó tapasztalat, diagnosztizálásnál nagyon jelentős: ilyen elváltozásokat kizárólag hasi (!) panaszokkal beérkező embereknél is találnak. És közben úgy tűnik, bár ez egyelőre csak benyomás, hogy a vírus talán alkalmazkodik, és mintha gyakrabban okozna súlyosabb betegséget fiatalok között is, komorbiditások nélkül is. További probléma, hogy az eü. személyzet nehezen jut tesztelési lehetőséghez a saját maga számára.
  • Intenzív osztályról — egy amerikai szakorvos a groupthink jelenségről számol be előbb: "Az orvos szerint a kórház személyzete körében sokáig népszerű álláspont volt, hogy a média túl nagy feneket kerít a vírus köré, és még a szakorvosok is azon a véleményen voltak, hogy lefolyásában nem lehet sokkal rosszabb, mint egy átlagos influenza". Aztán az ARDS-es betegekkel kapcsolatos borzalmakról: "a betegek gyakran próbálják kitépni a lélegeztető csöveket, mert úgy érzik, azok fojtogatják őket" + "Egy viszonylag fiatal férfit láttam, levegőért kapkodva, rózsaszínes, habos váladék jött ki a csöveiből és a szájából. A lélegeztetőgépnek működnie kellett volna, de még így is levegőért kapkodott, le kellett fognunk. Fertőzéseknél hozzá vagyok szokva a zöldes, sárgás színekhez, de az ARDS-es koronavírusos betegeknél rózsaszín váladékok is vannak, mivel vérsejtek kerülnek a légutakba."
  • Veneto és Lombardia megközelítése annyira eltért, hogy ez most már adatokban is remekül látszik. A lényeg, hogy Venetóban adtak a járvány teljes felderítésére, az aszimptomatikusakat is beleértve. Ebből a cikkből lehet erről olvasni (sokkal többről is szól ennél). Ez a tesztelési kapacitásban is megmutatkozik. Veneto 20 ezer tesztet akar naponta a következő három hétben, Lombardia, olvastam valahol, kb. 5000-et tud jelenleg max (naponta).
  • A New York Times cikkéből kiderül, hogy az idősotthonokban történt, utólag beazonosított COVID-19-es halálesetek nincsenek benne a hivatalos mutatóban. Ilyen eset volt 16 Haute-Marne-ban, 7 Haute-Savoie-ban, 20 Vosges-ban és 16 Párizsban már. Hány ilyen eset lehet még Franciaországban és a világban? Ezért van ott az "n" az általam vezetett globális halálozási mutatónál. Velük együtt így +2143+n most a járvány hivatalos áldozatai feletti halálesetek száma. Este 8-kor az összes: 30299+2143+n=32442.

2020.03.29.

Két cikk a járvány alakulásának távlatairól, jelentős részben az Egyesült Államokra fókuszálva. A Guardian azokról a menedzserlelkületű egyénekről ír, akik olyan érvekkel jönnek, miszerint a járvány kezelése "a gazdaság feláldozásába kerülhet, és akkor már jobb a gazdaságot működtetni tovább", nem értve, hogy ez a járvány agyonüti a gazdaságot, ha elengedik. Casey Mulligan (Trump egyik gazdasági tanácsadója, University of Chicago) szerint “It’s a little bit like, when you discover sex can be dangerous, you don’t come out and say: there should be no more sex”. Vagyis csak azért mert kínhalált halhatunk, még menjünk dolgozni, hiszen az nagyon jó dolog (munka=szex, ezek szerint), és ő, Mulligan legrosszabb esetben majd elmegy, és megkapja a legjobb kezelést a bajára, míg mások nem jutnak be a kórházba. A Foreign Affairsben ez a másik cikk pedig a társadalmi felfordulást helyezi kilátásba, azok után, hogy az USA-ban tömegesen válnak állástalanná és azzal együtt egészségügyi ellátáshoz hozzá nem férővé, biztosítatlanná emberek (akik így remekül zsarolhatók munkába menésre, jegyzem meg). Ilyenkor nagyon jól látszik, hogy a gazdaság hétköznapi működése is mennyi burkolt erőszakkal és a fizikai ártalmak elszenvedésének fenyegetésével jár együtt.

  • Egy 12 éves kislány súlyos beteg Atlantában.
  • Visszatekintés arra, hogyan terjedt szét a járvány Spanyolországban, így pl. a február 19-i, milánói Atalanta-València focimeccs szerepére ebben, ahol keveredtek a rajongók városszerte.
  • Hoppá. A német adatokról befutott némi információ, ebből a Spiegel-cikkből. Kiderül belőle, két nappal ez előttről, hogy akkor éppen 940 intenzív osztályos koronavírusos betegük volt, és ebből mintegy 640 kapott lélegeztetést. Most már korrigálták a WHO felé jelentett információkat, és jelenleg van eszerint 1581 kritikus/súlyos esetük. Ez is jobb, mint az olaszországi arányok, és ebben a jobb tesztelési teljesítmény szerepet játszik, de az is világos, hogy a németek kicsit jobbnak mutatták a képet, mint amilyen valójában volt, és ez nekem megdöbbentő. A probléma forrásai között ott a rendszer decentralizáltsága is. Angol fordításban a cikkből: "Not all German clinics with intensive care units are currently registered in the register, so the actual number of patients is likely to be higher." Wow. Németorszgából rossz adatokat kapunk. Meg lennék lepve, ha ez nem érintené a halálozást is.
  • Gyermekhalál Illinois-ban. Egy évnél fiatalabb volt, eddig legjobb tudomásom szerint ez az első eset.
  • 9444 spanyol egészségügyi dolgozó a fertőzöttek között.
  • Az operatív törzsből dr. Jakab Ferenc épp elmondta egy tévés interjúban (ATV), hogy nem tud szakmai összefüggésről a BCG-oltás és a virális fertőzések között. Akkor itt tudok segíteni: "Numerous epidemiological, clinical and immunological studies demonstrate that BCG vaccination impacts the immune response to subsequent infections, resulting in reduced morbidity and mortality. Important lines of evidence indicating that BCG protects against viral pathogens comes from experimental studies in mice showing that BCG offers protection against various DNA and RNA viruses, including herpes and influenza viruses. Recently, the effect of BCG on an experimental viral infection in humans has been demonstrated. These effects are thought to be mediated via the induction of innate immune memory and heterologous lymphocyte activation, resulting in enhanced cytokine production, macrophage activity, T-cell responses and antibody titres". (Moorlag et al.: Non-specific effects of BCG vaccine on viral infections.  2019 Dec;25(12):1473-1478. doi: 10.1016/j.cmi.2019.04.020. Epub 2019 May 2.)
  • Ha már szakirodalmazunk, itt van ez a cikk az aszimptomatikus fertőzésekről, hasznos háttérnek, azok után, hogy most, a SARS-CoV-2 kapcsán, vagy például pár éve a Zikával összefüggésben is, annyi figyelmet kaptak a tünetmentes lefolyás esetei.

2020.03.30.

  • Kénytelen vagyok a magyar bulvársajtóban szokásos kifejezést használni: Boris Johnsonék "beleszálltak" a kínaiakba. És mikor már épp elkezdene tűnődni az ember, hogy miért van ez, mikor januárban is lett volna erre alkalom, előkerül a Huawei ügye, és hogy nem biztos, hogy nekik piacot kellene adni a Júkéjben. Csak nem jobb üzletet remélnek egy kis nyomásgyakorlás révén?
  • Pénzügyminiszterek öngyilkosságáról hallani mindig fura dolog. Egyrészt ott vannak a fontos pénzügyek, amikkel foglalkoznak, másrészt pedig eltűnődik az ember, hogyan jött ki egy költség-haszon kalkulációból az illetőnek, hogy így lesz jobb. Mindenesetre Hesse állam pénzügyminisztere állítólag a koronavírus-válság feszültségét nem bírta, és ezért lett öngyilkos.
  • A Fülöp-szigeteken tegnap lezuhant a Lionair légitársaság egy gépe, 8 fővel a fedélzeten (3 fő repülőszemélyzet, 3 fő orvosi személyzet, egy páciens és a kísérője). Eredetileg azt írta a sajtó, hogy orvosi szállítmányt vitt Japánba, és furcsálltam, mert Japán nem szorul rá a Fülöp-szigetek ilyen szállításaira tipikusan. Kiderül, hogy "orvosi evakuációról" van szó, amire azért került sor, mert a páciens inkább Japánban szerzett magának kórházi helyet, miután a fülöp-szigeteki kórházban, ahol addig volt, elhelyeztek egy COVID-19-es beteget is.
  • Belgium után Indiából is jönnek hírek az orvosok zaklatásáról fertőzéstől tartó emberek által. Nem tudnak hazamenni, a kórházban kell aludniuk, sokaknak. Még a háztartási cselédeket is kizárják a lakóközösségeik. "Women who work as private ayahs – domestic servants – in hospitals described how they too had been driven out of their homes in the past few days".
  • Ugyancsak India. Az elmúlt időszak muszlimellenes zavargásai után vannak IDP-táborok, és most innen is elüldözik a rendőrök az otthonukat már korábban (most pedig a sátraikat is) elvesztett embereket, mondván, béreljenek maguknak helyet valahol.
  • Ha valaki ezt a tanulmányt elolvassa, megértheti, hogy az egykori SARS-járványnak 2003-ban nem igazán a meleg idő vetett véget: "Viruses stayed stable at (...) 37 degrees C for at least 2 h without remarkable change in the infectious ability in cells, but were converted to be non-infectious after 90-, 60- and 30-min exposure at 56 degrees C, at 67 degrees C and at 75 degrees C, respectively." Az, ami stabil 37 fokon, és 75 fokon 30 percig kell sütni, hogy baja legyen, az nem a meleg idő miatt fog eltűnni a világunkból. Ez persze a régi SARS, nem az update-elt programcsomag, de mivel a genomegyezés közel 80%-os, a fenti adatok alighanem mérvadók a környezeti stabilitást tekintve.
  • Két jó tanulmány is befutott alább (h/t Epikurosz). Ezek közül az egyik a BCG-vakcinával átoltottság mértékével összefüggésben jobb járványügyi helyzetet talál egyes országokban. Hollandia, az Egyesült Államok és Olaszország három példa olyan országokra, ahol a BCG-átoltottság gyengébb...
  • Belaruszban Lukasenka elnök megnyilvánult: "Alexander Lukashenko has called concerns about the coronavirus a "psychosis" and joked that going to saunas and drinking vodka could prevent infection".

2020.03.31.

New Yorkban tömegek nézték a USNS Comfort kórházhajó érkezését. Hogy ezt a hírt megfelelően tudjuk értelmezni, kicsit ki kell mozdulni a Comfort-zónából.... Tehát megismétlem lassan. Tömegek. Nézték. Együtt. A kórházhajó érkezését.

usnscomfort.jpg

  • A koronavírus Jászberényben. Van itt nyomozni való. Azt írja a polgármester: "A néni és családja felelősen viselkedett, a hozzátartozók otthon tartották és ellátták idős rokonukat, a vírust közülük vihette haza valaki." Kérdések (ha a polgármester jól mondja). A hozzátartozók aszimptomatikusak? Teszteljük őket nagyon gyorsan, ugye?
  • Svédország egyelőre teszteléssel és jó kapcsolatkövető munkával tartja a frontot, és ezért úgy tűnik nekik, nem is kell leállnia az életnek nagyon. Drukkolok nekik, de azt látni kell, hogy csak a tesztelés és a kapcsolatkövetés révén működhet ez a megközelítés, máskülönben már elszabadult volna ott is a járvány, és ezért nem ajánlanám ezt a stratégiát... kevésbé átfogó és kevésbé körültekintő járványügyi eljárás esetén. Dánia közben a járvány elengedéséről és az élet újraindításáról gondolkodik. Igazából nagyon egyszerű mi történik az ilyen, indokolatlan lazításoknál, amikor a járvány nyilvánvaló növekedési potenciálja ellenére lépnek. Meg lehet nézni ezeken a görbéken 1918-ból. Van teve egypúpú, van teve kétpúpú stb.
  • A kínai vezetés arcátlanságáról, ami természetesen rezsimbiztonsági érdekekből következik. A kínai piacok pedig újranyitottak, és a jelek szerint újra lehet árulni állatokat korlátozások nélkül. Illetve vannak korlátozások: egyes helyeken biztonsági őrök igyekeznek akadályozni, hogy fotók készüljenek erről...
  • Ausztrália megpróbálkozik a BCG-(újra)oltással az egészségügyi dolgozók esetében, RCT-sémában, hogy ebből generalizálni is lehessen.
  • Eset Seattle-ben: 60 fő, két és fél órán át együtt éneklő, egészségesnek mutatkozó kórustagból 45 volt fertőzött három héten belül (kettő halott: 4,4%-os CFR), annak ellenére, hogy nem fogtak kezet, nem ölelkeztek, és még kézfertőtlenítőt is kaptak a bejáratnál. Na ja, de hát teli tüdőből énekeltek. Nekem ez még mindig inkább cseppfertőzés, mint az a fajta aeroszolizáció, amit a kanyarónál látni. Ha a kórustagok egymástól végig 2-3 méteres távolságot tartva is ilyen mértékű átfertőzöttséget produkáltak volna, igazán az engedne másra következtetni. Viszont nagy félreértés a cseppfertőzésre úgy gondolni, mint ami csak köhögés vagy tüsszögés esetén lehetséges, vagy mondjuk csak 1-2 méteres távolságon belül. Cseppfertőzéssel is lehet tömegeket beteríteni.
  • India nyomornegyedeiben ilyen higiéniai körülmények várnak a koronavírusra: "In Dharavi in Mumbai, for example, there is only one toilet per 1,440 residents, according to a recent CFS study -- and 78% of community toilets in Mumbai's slums lack a water supply, according to 2019 Greater Mumbai Municipal Corporation survey."

2020.04.01.

  • Adatok a CDC-től a súlyos esetek előfordulásáról. Két dologra hívnám fel a figyelmet: (1) a 20-44 éves korcsoportban 14,3-20,8%-os hospitalizációs arány, a 45-54 éves csoportban pedig 5,4-10,4%-os intenzív osztályi kezelési arány. Egyfelől jó látni, hogy még a nagyon idősek többsége is túléli a betegséget, másfelől rossz látni, hogy ez még a fiatalok jelentős részénél is kórházi kirándulással jár együtt.
  • A kormány idehaza váratlanul megosztott adatokat az elhunytak krónikus problémáiról. Nem GDPR-kompatibilis, ha pl. a 38 éves brit diplomatára gondolunk, aki a táblázatból kikereshető. És igazából nem erre lenne szükség. Csak a krónikus betegségek előfordulása érdekelne a populációban, nem az, hogy pl. 12-esnek mi baja volt konkrétan. Kellenének viszont területi adatok + információ a visszakövetett kontaktokról, ha (például) a kecerakoncai gittegylet legutolsó értekezletének résztvevői közül már többen fertőzöttek.
  • Egy tanulmány a gyulladáscsökkentés szerepéről, tekintve, hogy a COVID-19-es betegeknél a citokinvihar komoly probléma, mely itt ráadásul két hullámban jön, és a tüdő felől induló első hullámot egy szisztemikus, a T-limfociták kiváltotta második követi. Az utóbbi ellen, a súlyos, gyors állapotromlás kapcsán, annak észlelésekor bevetendők lehetnek kortikoszteroidok és citokininhibitorok, de azzal együtt, hogy közben az immunválaszt sem jó akadályozni (pláne az ilyenkor már fellépett immunhiány mellett) — pl. az IFN-α interferonok termelését sem. A tocilizumab (TCZ) cikokininhibitort említik Haiming et al. alapján sikeresen alkalmazható szerként, mint ami jó hatással volt a betegekre.
  • Egy másik thai esetről is írtam, ahol dengue-lázként történt félrediagnosztizálás. Itt egy felgyógyult betegről van szó, megint Thaiföldön, akinél ugyanez történt. Az ízületi fájdalmak is előfordulnak tünetként, tanulság. A hétvégén egy magyar gyógyult beteg beszámolójában is hallottam, hogy "mindenem fájt, még a bőröm is".
  • Ebben a tanulmányban a gasztrointesztinális problémák előfordulását nézték COVID-19-nél, és azon kívül, hogy ilyenek voltak sokaknál, itt van ez a diagnosztikai (és a terjedési utakat tekintve is) jelentős információ: "Faecal PCR testing was as accurate as respiratory specimen PCR detection".
  • Pedig Bruce Aylward amúgy komoly ember, WHO-tisztviselőként. De amikor Tajvanról kérdezik: (1) eljátssza, hogy nem hallotta a kérdést; (2) félbeszakítja az újságírót azzal, hogy na most már menjünk tovább; (3) kinyomja a beszélgetést; (4) végül lezárja a témát azzal, hogy "We have already talked about China".
  • Trump sajtótájékoztatón mondta a következő, döntéshozatali szempontból érdekes dolgokat: "I've had many friends -- businesspeople -- people with great, actually, common sense, they said, 'Why don't we ride it out?' A lot of people have said -- a lot of people have thought about it. 'Ride it out. Don't do anything, just ride it out and think of it as the flu.'" Madarat tolláról, embert a darwinista menedzser barátairól, ahogy az ősi mondás is tartja. Persze Trump új narratívájában ő volt a vizionárius vezető, aki felismerte, hogy ezek az emberek tévednek, és nem Anthony Faucinak kellett a hülyeségnek keresztbefeküdnie még a szakmai autoritásával együtt is komoly kockázatot vállalva ezért (mi van, ha Trump kirúgja?).
  • Nem túl meglepő módon Egyiptomban a zsarnoki megközelítést erősíti a járvány (is). Türkmenisztán kitiltotta a koronavírust az emberek diskurzusából, úgyhogy ott nem lehet gond. Update: már a türkmén (100%-ig állami) média is említi a járványt, úgyhogy mégis lehet ott gond.
  • Hajók. A USS Theodore Roosevelt repülőgéphordozón már 100 fertőzött van, jelenleg Guamnál. Ez kezdi komolyan érinteni az amerikai katonaierő-kivetítési képességet, és az ilyesmi instabilitást hozhat. Florida felé tart a Zaandam turistahajó — már négyen meghaltak a fedélzetén, úgy, hogy egyelőre nem hogy a holtakat, de még az élőket sem tekinti egy ország sem a sajátjának. Ha jól számolom, 132 aktív esetük van, 60 gyógyult (és a 4 halott) mellett.
  • Olasz minisztériumi anyag feltételezi, hogy az idén enyhébb influenzajárvány által érintetlenül hagyott populációból ölt meg sokakat ott a koronavírus-járvány. Annyi lehet ebben, hogy egy virális fertőzés, ha nem zúz nagyon le valakit, felpörgetheti az immunrendszerét, és az is igaz, hogy akit az influenza elvitt volna, azt a koronavírus egészen biztosan elviheti, de azért ez így spekulatív megállapítás.
  • 525 fertőzöttnél járunk most. Müller Cecília tiszti főorvos jelenti a következőket "még mindig igaz a feltételezésünk, hogy a fertőzöttek egymásnak adják át a fertőzést, egy-két személynek, szoros kontaktoknak" + "bármelyik településen jelen van a vírus" + "mindnyájan, akik vagyunk, kitettek vagyunk" + nem tudjuk, hogy ki, kitől kapja el, valószínűsítjük, de ezt most már, ilyen megbetegedésszámban nem egészen tudjuk beazonosítani". Én jelezném, hogy a kapcsolatkövetés elengedésére ne tessék készülni, olyat ennél a járványnál nem lehet csinálni.
  • In other news, Kínában megugrott a válások száma egyes helyekén, legalábbis anekdotikus bizonyíték van erre. Kitörés a karanténból?
  • Kedvenc pulmonológusom, Dr. Roger Seheult egy nagyon-nagyon ütős gondolattal szolgált legutóbbi podcastjében: míg a spanyolnátha idején arra koncentrált az egészségügyi rendszer, hogy az esetek ne jussanak el a (bakteriális társfertőzés nyomán fellépő) tüdőgyulladásig, mert onnantól rosszabbak voltak az esélyek (nem volt még penicillin), ma a rendszer elküldi a beteget haza azzal, hogy majd akkor jöjjön, ha tüdőgyulladása van... 
  • Svédországban gondok lesznek.
  • Nehéz időkben is jut idő egy kis képmutatással egybekötött (ügyes) érdekérvényesítésre. Európai orvosi-humanitárius segélycsomag Iránnak, hogy egy füst alatt leteszteljék az INSTEX mechanizmust, és hogy az amerikaiak mennyire akadnak ki... egy olyan esetben, ahol és amikor a kiakadásuk nyilván kevésbé valószínűsíthető.

2020.04.02.

  • Újabb review előtti paper. Azt már tudjuk, hogy a SARS-2, mikor pályára áll, bántja a tüdő légzsákjait szövetközileg, zúzza a szívet, vesét, vékonybeleket, belezavar a renin-angiotenzin rendszerbe (és a vérnyomás szabályozásába), a szövetközi pneumónián keresztül megfosztja a szervezetet az oxigéntől stb. Itt egy újabb, lehetséges, gonosz kis mechanizmusa, ezzel is fojtogathat: egyes fehérjéi kötődnek a porfirinhez a vörösvértestek által hordozott hemoglobinban, talán csökkentve így az oxigén és a széndioxid (ki-be légzés kapcsán történő) szállításához rendelkezésre álló hemoglobin-kapacitást is. Kieg.: a virális proteinek porfirinhez kötődése akár vasat is leválaszthatja a hemoglobinról... para, ha igaz. Bár vannak, akik egyelőre az egészet vitatják. Mindenesetre csökkent vörösvértestszám gyakorinak tűnik a COVID-19-nél, és a folyamatban talán a baszigin (CD147) is szerepet játszhat, mely a vírus számára pl. a T-limfocitáknál is bejutási pont. Lásd ezt az elemzést további lehetőségekről. Figyelemre méltó érv innen: "Preliminary evidence suggests that CD147, the determinant of the Ok blood group system, binds the spike protein of SARS-CoV-2 (Wang 2020). Incidentally, CD147 functions as an essential receptor for erythrocyte invasion by Plasmodium falciparum." Hivatkozik erre: Crosnier 2011.
  • Maszkháború (persze a gyógyszerekért is ez megy). Kína sok selejtet szállít, miközben a repülőterein még így is egymásra licitálnak a beszerezni vágyó nyugati országok.
  • Hardcore: egy eset, ahol vélhetően a fertőzés következményeként állt elő akut nekrotizáló vérzéses enkefalopátia. Az agyi-gerincvelői folyadék negatív volt lehetséges egyéb gyanúsítottakra, és a hölgynek volt SARS-CoV-2-pozitív orr/torok-törlete. 
  • A COVID-19 következményeként előforduló ARDS atipikus jellege. Az egyik következtetés, amire jut, hogy " intubation should be prioritized", aminek senki nem fog örülni, de ha még tud nem örülni valaminek, az például azért lehet, mert túlél. Érdekes, hogy a levél írói szerint nem feltétlenül kell a "prone positioning" (hasra fektetés), mert itt szerintük ez minimális előnyt nyújt, miközben több emberi munkát igényel az ilyen páciens ellátása.
  • Nagyon érdekes tanulmány Pteropus alecto denevérek sejtjeivel és különféle vírusokkal folytatott kísérletekről, RNAi és CRISPR technológiák használatával (egyes gének ideiglenes semlegesítéséhez vagy kikapcsolásához), amiből az jön ki, hogy az MTHFD1 gén semlegesítése inhibitorként pl. carolacton bevetésével akadályozza influenza A, mumpsz, Zika, SARS-CoV-2 és Melaka-vírusok replikációját. A carolacton citotoxikus, de a tanulmány szerint "The cytotoxic effect is very moderate ... supporting a therapeutic window of this compound in potential clinical applications."
  • 10-6-8. Ez a sorozat azt mutatja, hogyan duplázódott a halálesetek száma április 1-ig, előbb 5000-ről 10000-re, majd 10000-ről 20000-re, majd onnan 40000-re. Tegnap óta pedig van +10000 haláleset. Az exponenciális növekedés egyik legcsúnyábbik vetülete.

2020.04.03.

  • Dáccs öprócs (Dutch approach). Ez a cikk azt fejti ki, hogy az ő kórházaikban az intenzív osztályra idős betegeket általában sem szeretnek fogadni. Palliatív kezelést adnak inkább. A mostani járvány kontextusában pláne, hetekig tartó invazív "tüdőpótló" kezelés helyett. És így akkor nem is fogynak majd ki (szerintük) az ICU-kapacitásból. Olaszországban és Németországban ezt úgy hívják, hogy diszkrimináció, és nem így csinálják.
  • A franciák bejelentettek 882 (!) extra halálesetet idősotthonokból országszerte. Már korábban jeleztem a problémát, hogy csak a kórházi eseteket számolták, és 59 esetről volt akkor tudomásom. Ezt az 59-et kivontam most az általam számon tartott extra halálesetek számából, mely így 2084 akkor.
  • Ecuadorban is nagyon rossz a helyzet. 120 hivatalos halálesetük van, de kb. 400 utcára kitett vagy másutt elhagyott holttestet gyűjtöttek be ott a napokban. 2084+400. Innentől látszik igazán, hogy az influenza halálozásainak feltételezésalapú statisztikai számítása inflálólag (felnagyítólag) hat az influenza halálosságának megítélésére, miközben a COVID-19-nél először is megerősített esetekben számolunk, és ezzel alá lövünk a valós adatnak.
  • A USS Theodore Roosevelt repülőgéphordozó kapitányát felmentették a szolgálat alól, amiért "túl széles körben" terjesztett feljegyzésben a legénység szárazföldi elkülönítését javasolta két hétre a fedélzeten lévő fertőzöttek miatt.
  • Van a bürokratikus tempójú kapcsolatkövetés. És van az, amire ennél a járványnál van szükség. Az idézett tanulmány számításai szerint: "the emerging evidence for shorter generation times for COVID-19 implies a smaller R0 (than what was estimated by earlier studies). This means a smaller fraction of transmissions need to be blocked for sustained epidemic suppression (R < 1). However, it does not mean sustained epidemic suppression will be easier to achieve because each individual’s transmissions occur in a shorter window of time." Szóval nagyon-nagyon gyorsnak kell lenni, és ezt digitális eszközökkel kellhet támogatni.
  • Dél-Afrikában meghalt COVID-19-ben Gita Ramjee HIV/AIDS-kutató, aki virológusként megelőzési programokon dolgozott. Ugyanitt említik, hogy a rendőrök már három embert lelőttek a kijárási korlátozások betartatása során. Bheki Cele rendészeti miniszter ezt kb. vállrándítással nyugtázta: “You haven’t seen anything yet.” Közben a dél-afrikai townshipekben is súlyos körülmények közé érkezik a járvány: az egész országra vetítve csak az emberek 44,4%-ának van vízhez hozzáférése a saját otthonában. (2484+3.) Van itt azután 300 ezer tuberkulózisos beteg, nagy részük HIV-pozitív (összesen 7.8 millióan HIV-pozitívak, közülük kb. félmillióan súlyos immunhiánnyal).
  • Ilyenkor bizony a terhesgondozás és az abortuszok is komoly problémát jelentenek, az eü. rendszer leterheltsége miatt.
  • PCR sample pooling. Ennek is eljöhet az ideje. Egy crowdsourced kezdeményezés, többek között erre a tanulmányra alapoz, mely a juhok "büdös sántaság" nevű, Dichelobacter nodosus baktérium által okozott betegségéhez kapcsolódóan demonstrálta az ilyen tesztelés megfelelő érzékenységét és megvalósíthatóságát. A lényeg a gyorsabb, hatékonyabb tesztelés, mely skálahozadékot produkál. Idézem a crowdsourced anyagot a megközelítésről: "Hátránya, ami egyben előnye: 15-64-szeres fals pozitívot ad, azaz az egy körben mért személyek mindegyike azt a jelzést kapja, hogy kérjük nagyon komoly karantént tartson, mert komoly eséllyel megfertőz másokat. Ez viselkedésben lényegesen eltérő eredményre vezet, mint a jelenlegi, “én biztosan nem vagyok beteg” magatartás." Mint írják, erről a megközelítésről el lehet gondolkodni települési, kistérségi szinten is ám, szóval pilot projectként lehetne kezdeni akár holnap is.

INDÍTOK ÚJ BEJEGYZÉST, HOGY NE KELLJEN ANNYIT LEFELÉ GÖRGETNI, LÁSD FELJEBB.

28 komment

A koronavírus-válság eszkalációja (új, frissülő bejegyzés)

2020.03.07. 15:17 :: Marton Péter

Ezt a bejegyzés azért nyitom, hogy az innentől következő dolgok közül a leginkább figyelemre méltó történéseket listázzam, kutatási jegyzetként. Előzmények, ugyancsak tőlem:

2020.03.07.

  • Nyugdíjas orvosok mozgósítása Olaszországban. Az olasz pártpolitikai elitet is elérte a járvány. Az iskolák és egyetemek egyelőre ideiglenes bezárásán már túl vagyunk — az egyértelműség kedvéért: utóbbi lépések azért hasznosak, mert a gyerekseregletek, illetve a bulizós és ugyancsak tömegesen érintkező fiatal felnőtt populációk olyanok a járványnak, mint a dopping, függetlenül attól, hogy a fiatalabbak mennyire betegednek meg.
  • Tudósítás Olaszországból, lombardiai intenzív osztályról.
  • Közben egy amerikai tengerész Nápolyban szintén elkapta a fertőzést, úgyhogy ez úton jelezném minden releváns járványügyi hatóságnak a nyilvánvalót: Olaszország egésze fertőzött terület. Nem kicsit, hanem nagyon.
  • Kutatási eredmények Szingapúrból: a koronavírus enyhe tüneteket mutató, szárazon köhögő ember után is beterít mindent az általa belélegzett és beköhögött helyiségekben (de a fertőtlenítés végez vele). Vécék környékén is erős környezeti jelenlét, sőt a vécécsészében is: újabb bizonyíték, hogy a fekális-orális terjedési útnak alighanem jelentősége van. Cseppfertőzéssel terjed a vírus, de a cseppek jó messzire szállnak vele, messzebb, mint azt bürokraták feltételezik jelenleg. Ez nem kevesebb, mint jó eséllyel "a" magyarázat arra, amit eddig láttunk. Ezért szökik meg minden körülzárási kísérletből ez a kórokozó. Hihetetlenül hatékonyan szóródik cseppekkel is, és utána hosszan, napokig megmarad a felületeken. Valaki mindig felszedi a környezetből, a legtöbbször nem is kevesen. Aki megfertőződik, pl. mert kézzel nyálkahártyához juttatja el a vírusrészecskét, utána akár 14 napig (sőt még tovább is) aszimptomatikus, de már egyre fertőzőképesebb, vagyis a környezet terítéséhez maga is hozzájárul már ez alatt. És aztán a ciklus újrakezdődik.
  • A Grand Princess hajó kálváriája csak most kezdődik igazán. Diamond Princess, reloaded. Sajnos az amerikai hatóságok sem belátóak: költséges lenne az utasokat a szárazföldre kipakolni, de sokkal költségesebb lesz tízszer-százszor több fertőzöttel foglalkozni, és utána nézni, hogy tőlük továbbterjed a betegség, miután végül mégis landolnak. Az egyik tudósításban hallottam egy rákbeteg hölgyet az utasok közül, aki aggódott, hogy a jövő héten esedékes sugárterápiás kezeléséről lemarad. Őszintén nem értem, miért kellett akkor most egy ilyen hajós utazásba belevágnia, de remélem, gondoskodnak róla valahogyan.
  • Az amerikai kórházak egészségügyi védőfelszerelésekből rendelkezésre álló készletei is elképesztően soványak.
  • Javaslat eü. személyzet figyelmébe: ha a készletek megőrzése a cél, akkor lehet pl. 9 naponta használni egy-egy maszkot. Ennél tovább nem marad fertőzőképes a SARS-CoV-2.
  • Egyes nagyon hülye emberek az Egyesült Királyságban ismét bebizonyították (l. hosszú cikken belül), hogy nagyon hülyék: szingapúri cserehallgatóra támadtak azzal, hogy nem akarják a koronavírusát, menjen inkább haza. Pedig nem lenne olyan nehéz tájékozódniuk róla, kinek az országa fertőzöttebb.
  • Új eset Magyarországon, súlyosan beteg, hetven éves férfi, akit külföldön élő fia fertőzhetett meg még február közepén, amikor Olaszország és Franciaország után látogatóban nála járt. Kérdések: a fia ezek szerint volt beteg, ezt biztosan tudjuk? Annak a másik országnak a hatóságaitól tudjuk, ahol ő él? Vagy tőle magától? Amikor az édesapjánál járt, mutatott tüneteket? Pontosan mikor járt itthon?  (A "február közepe" elég homályos.) Mennyi volt a vélhető inkubációs idő az édesapa esetében? Kieg. március 9-én: az Index cikke szerint az idős férfi fia járt a Szent Lászlóban háziorvosi továbbküldés nyomán, explicit módon említett koronavírus-gyanúval, de a cikkben nem szerepel, hogy toroktörletet vettek volna tőle, és úgy tűnik, röntgenezgették és vért vettek tőle elsősorban, majd elküldték. Sajnos a röntgen nem igazán alkalmas a koronavírus-fertőzéssel kapcsolatos abnormalitások kimutatására a tüdőben, mint korábban jeleztem. Ha röntgenre kell hagyatkozni, akkor a legjobb radiológusainknak is fel van adva a lecke.
  • Március 15. off.
  • Iránban ma többek között egy parlamenti képviselő, Fatemeh Rahbar halt meg COVID-19-ben. Közben az iráni vezetők a szokásos sértődős propagandát nyomják sajnos, és amerikai bio-, gazdasági és egészségügyi terrorizmusról beszélnek, ami nem növeli a valószínűségét annak, hogy valaki együttműködjön velük.
  • Részletes adatok ebben a cikkben a halálesetek valós számáról Iránban kórházi forrásoktól. A cikk előbb a MEK (népi mudzsahedek) komolytalankodását idézi, de utána ott vannak ezek az adatok kórházaktól, ahol látják, mennyien haltak meg a jellegzetes CT-eredményekkel, anélkül, hogy tesztelték vagy esetként regisztrálták volna őket. E szerint március 3-ig: Teheránban 150 halott; Iszfahanban 46 halott; Gilánban 23; Loresztánban 18; Kermansahban 45; Komban pedig "minimum" 300. Összesen: 582. 
  • Thaiföldről egy figyelemre méltó cikk: egy nyilvánvaló COVID-19-es eset (Dengue-láznak igyekeztek feltüntetni). Többszörös szervi működési elégtelenséggel végződött, de előtte még egy kórházi ápolót is megfertőzött az elhunyt — az ápoló felépült, de a tüdeje tartósan károsodott. Az eset jelentősége: 1) Thaiföldön vannak esetek, és nem jelentik ezeket korrekt módon; 2) az ápoló sorsa is figyelemre méltó, mert mutatja, hogy a betegségből "meggyógyulni" nem biztos, hogy teljes felépülést jelent mindenkinek. 
  • A kínai Csüancsouban (Quanzhou) összeomlott egy karanténozáshoz használt hotel épülete. Állítólag volt egy robbanás az omlás pillanatát megelőzően. Később kiegészítem ezt befutó információkkal. Kieg.: 2018-ban átadott épület volt, hétemeletes, úgy tűnik, láthatóvá vált szerekezeti hibával, amiről jelzés is érkezett az omlás előtt közvetlenül. Odabenn 58 karanténezett személy, 16 fő hotelszemélyzet és egy autóügynökség 6 alkalmazottja. 38 embert kimentettek, 10 halott, 23 fő missing.
  • A fentebb Iránról és Thaiföldről szóló pontok fényében a teljes halálozás március 7-én globálisan: ALSÓ ÉRTÉK = 3569+7+1+3=3579. Magyarázat: Hivatalos adatok 22:21-kor; 7 nem-számolt COVID-19-es haláleset (5 Kínából, 1 Olaszországból, 1 Thaiföldről); 1+3 közvetett haláleset (egy karanaténezés miatt magára hagyott, agyi bénulásban szenvedő áldozat + checkpoint violence Kínában 2 áldozattal és 1 halálra ítélttel). FELSŐ ÉRTÉK = 3569+1+1000+482+3+1+3+1+n = 5060+n. Magyarázat: Hivatalos adatok 22:21-kor; 1 olasz nem-számolt eset; 1 thaiföldi nem-számolt eset; 1 karanaténezés miatt magára hagyott, agyi bénulásban szenvedő áldozat; 1000 valószínű, pozitív PCR-teszt nélküli kínai haláleset; 482 extra iráni haláleset kórházi források szerint; 3 valószínű észak-koreai haláleset; 3 halott checkpoint violence-hez kapcsolódóan Kínában; n számú ismeretlen haláleset a tévesen vagy manipulatívan jelentő országokban. Ehhez még hozzájönnek a csüancsoui szálló alatt rekedtek (10-en, jelen állás szerint). A fenti logika szerint a továbbiakban naponta közlök összesítést.

2020.03.08.

  • Kiterjesztik a karantént egész Lombardiára Olaszországban. Mozik, színházak, edzőtermek, klubok, diszkók bezárnak, nincsenek esküvők és temetések. A karantént elhagyni csak "komoly okkal" lehetséges.
  • Szükségállapotot hirdettek New York államban.
  • Az újabb két magyarországi fertőzött közül az egyik iráni diák, és február 28-án, születésnapi bulin fertőződött meg diáktársától, a másik pedig a Milánóból Debrecenbe hazatért férfi felesége.
  • Nézegettem különböző társadalmak korfáit, és ha Iránban ennyi idős ember hal meg (mivel az egy fiatalabb társadalom), az csak úgy lehetséges, ha rengeteg fiatalabb fertőzött van. Ez a faktor is helyet kell, hogy kapjon a modellekben.
  • Az Egyesült Államokban az egészségügyi rendszer egyelőre alig működik, ezt nem lehet szebben mondani. Nem tesztelnek, nem tudnak tesztelni, nem akarnak tesztelni, és ehhez jön a világ legdrágább, fizetős eü. rendszereinek egyike. Innen pedig kiderül, miért pont a világ elitcsapatához tartozó CDC nem volt képes megfelelő tesztkiteket készíteni. Olyan tesztet akartak, ami egyben, egyszerre minden bétakoronavírusra szűr. Komoly ambíció volt, nagyobb eséllyel a kudarcra, ami be is következett. Ezzel "mindössze" heteket vesztettek egy logaritmukusan növekvő járvánnyal szemben :( Spekulatíve szinte látom magam előtt, amint egy zseni, akinek biztosan neve is van, a kezdetek kezdetén megszólalt: "Na de tegyünk egy lépést hátra! Miért nem csinálunk egy igazán költséghatékony szupertesztet! Meg tudjátok csinálni?"
  • Trump szerepe a történésekben. Trump óhajtotta, hogy a Grand Princess utasai inkább maradjanak a hajójukon, szemben Pence alelnökkel, akit amúgy maga bízott meg a válság-válaszadás vezetésével. "I don't need to have the numbers double because of one ship that wasn't our fault" — mondta minden idők legnagyobb IQ-val megáldott vezetője. Kieg. 18:30-kor: úgy néz ki, végül győz a józan ész, és a következő napokban leszállhatnak az utasok a fedélzetről Oaklandban (Bay Area).
  • Ezt a threadet végigolvasni mindenkinek, aki a válsággal kapcsolatban tervezéssel foglalkozik, alapvető jelentőséggel bírhat.
  • Szomorú dolog nézni, ahogyan a világ megőrül: nehéz máshogyan leírni azt, ami a görög-török határnál történik. A törökök migránsokat és menekülteket tereltek a határra, a görögök elkezdték összeverni, a tengerről pedig visszaűzni őket, erre a törökök elkezdték visszahajtani őket, és újabban még a görög határkerítés bontásával is foglalatoskodnak. Ennek a járvánnyal kapcsolatos válsághoz pl. azért van köze, mert a két oldal által oda-vissza pingpongozott populáció nagyon kemény kockázatnak van kitéve, ha megjelenik közöttük a fertőzés, és finoman szólva nem ideális higiéniai körülmények között élnek jelenleg.
  • Egy turistahajó. És hozzá Egyiptom problémái a hivatalosan nem is létező járvánnyal. Thaiföldhöz hasonlóan turizmusfüggő ország.
  • Az Egyesült Államokból a kirklandi idősek otthonabeli klaszter sorsa: az ott dolgozók nagy része elillant. Tanulságos ez is.
  • Egy eset Franciaországból, ahol az orvos, aki először megnézte a betegeket, simán lenyomta a "tüdőgyulladás, tehát antibiotikum" rutint, és csak később derült ki, állapotromlás nyomán, hogy COVID-19 a megfejtés. A francia tervek közben teljesen nyíltan beszélnek arról, hogy hamarosan jön a "3-as fázis". Helyi, közösségi terjedés. Nem fogják megállítani az életet és a gazdaságot, helyben hozott intézkedések lesznek a megoldás. Idézem: « On ne paralysera pas la vie économique et sociale du pays », promet le ministre de la santé, Olivier Véran, dans un entretien à Libération vendredi 6 mars. « Quand l’épidémie est là, il s’agit surtout d’organiser le système d’alerte et de soin, et d’assurer la continuité des services de l’Etat, sans empêcher les citoyens de vivre. » Továbbá: "... il ne s’agira plus de contenir le virus, mais d’éviter qu’il ne fasse trop de victimes. « En phase épidémique, la priorité sera la protection des personnes fragiles et le maintien des capacités de réanimation », insiste Aurélien Rousseau, le directeur de l’agence régionale de santé (ARS) d’Ile-de-France".
  • A mellkasi CT-eredmények tanulságairól cikk a Lancetben, még február végéről. Egy apró megjegyzésnél állnék meg: "the ease of access to CT in China..." Ennek a hátterét nem ismerem, de óriási jelentősége van, mert a CT sokkal érzékenyebb és alkalmasabb éppen ezért diagnosztizálásra COVID-19 esetén. Kieg.: Kína saját gyártási potenciáljának utánanéztem CT-k terén, és ezt találtam például. Az amerikai GE Healthcare mellett a kínai United Imaging és Neusoft a globális piacvezetők.
  • Halálozás. ALSÓ ÉRTÉK = 3802+7+1+3+10=3823. FELSŐ ÉRTÉK = 3802+1+1000+482+3+1+1+3+10+n = 5303+n.

2020.03.09.

  • Börtönlázadások Olaszországban, eddig 6 halott. (Lásd itt is.) Helyszínek: Modena, Milánó, Pavia, Salerno, Nápoly, Alessandria, Vercelli, Bari, Palermo, Foggia és Frosinone. Olaszország börtönállapotait sok kritika érte már a múltban. A börtönállapotokról és az ottani helyzet kezeléséről is érdemes előre gondolkodni, pl. olyan országokban, ahol a rabok gyártják az eü. felszereléseket (pl. a maszkokat).
  • Egyes légitársaságok akár üresen vagy közel-üresen is tovább járatják a gépeiket bizonyos vonalakon. Azért égetik szellemjáratokon a kerozint, mert Európában pl. a slot 80% alatti betöltetlensége esetén másnak adható át. Ez tehát rezervációs költség, úgymond.
  • Egy cikk a wuhani karanténban élő emberekről. És Kína társadalmi egyenlőtlenségeiről. Érdekes az is, hogy nem árt járványügyben jelnyelven és külföldiül is kommunikálni. És nem lehet mindenkiről egységesen haladó WeChat-felhasználói skilleket feltételezni, hogy aztán online tudja megrendelni az élelmiszereket. Közben ebből a cikkből értesültem egy újabb halálesetről is, ami a járványhoz köthető: "A 6-year-old boy was found in an apartment in Shiyan, also in Hubei, alone with the body of his grandfather; he told community workers that he hadn’t gone out to ask for help because his grandfather told him the virus was outside." Persze elmélkedhetünk, hogy akik ebben a járványban meghaltak, másban is meghalhattak volna, de azért minden ilyen relativizáció előtt fontos először is képpel bírni az áldozatok számáról, úgyhogy +1.
  • A járványkommunikáció nyilván kritikus kérdés (szerintem egyébként az őszinteség+pontosság viszonylag jól leírja a lényegét... it ain't rocket science). Trump ebből a szempontból? Nos...
  • Szaúd-Arábia lezárja a síita többségű Katíf (Qatif) körzetét új esetek miatt. Nem tesz jót a szunnita-síita viszonynak ott.
  • TOVÁBBRA SINCS KORONAVÍRUSOS ESET TÖRÖKORSZÁGBAN. TECIKÉRTENI? Zseniális magyar kutató előrejelezni probléma. Kiolvasni számokból igazság. Stb.
  • A tőzsdék. Az orosz-szaúdi megegyezés hiányában lesz túltermelés, és tovább esik az olaj ára. A Dow Jones pedig akkorát zuhant, hogy az szó szerint kivert egy biztosítékot, és volt ideiglenes kereskedésblokkolás. Az arany hétéves csúcsponton. Kieg.: ez alapján a cikk alapján úgy tűnik, a szaúdiak gyáva nyúl játszmában állnak az oroszokkal, és azon versenyeznek, licitáló jelleggel, hogy kinek fáj az olajáresés jobban. Közben: jaj, azok a MOL-részvények.
  • Kínai adat-aluljelentés? Ebben a beszélgetésben elhangzik olyan értesülés, kínai orvosi forrásokra hivatkozva, miszerint a kórházakban megvan adva egy kvóta, aminél több esetet jelenteni adott időn belül már nem lehet, és az extra eseteket máshogyan kell könyvelni. Nyilván nem tudom ellenőrizni, hogy így van-e. De sokan tűnődnek ilyesmiken.
  • Halálozás. ALSÓ ÉRTÉK = 4003+8+1+3+10+6=4031. FELSŐ ÉRTÉK = 4003+2+1000+482+3+1+1+3+10+6+n = 5511+n. A kínai checkpoint violence és szállodaomlás eseteket és az olasz börtönlázadás esetet összevonva közlöm holnaptól: 3+10+6=19.

2020.03.10.

  • Miután Kína tegnap már csak 22 új esetet regisztrált, komoly kérdés, hogy meg lehet-e ebben bízni. Érdekes ellentmondás például az új esetek minimálisra csökkenő száma kapcsán, hogy Xi Jinping mennyire aggódik Peking biztonságáért. Ott vannak azután a "szellemgyárak", ahol fogyasztják az áramot, hogy jelezzék — először is a tartományi szint felől a kínai központ felé —, hogy náluk már nagyon jó a helyzet, és újra van termelés. Ha tervezett és a helyi hatóságok által a tervek szerint szállított valóság van a gyári termelés terén, akkor ez sajnos a járvány ügyében is kellemetlen következtetéseket sugall. A gazdaság pusztulása pedig óriási nyomást fejt ki Pekingre, hogy valahogyan, bármi áron újraindítsa az életet. Úgyhogy figyelni kell majd, exportálódnak-e újra kínai  eredetű esetek olyan országokba, ahol egyelőre nincs komolyabb helyi járvány, illetve ahol ténylegesen tudhatják is ezt. Sajnos az ilyen országok fogyóban, és így az esetlegesen exportálódó esetek láthatatlanabbak lesznek. De azért csak tartsa mindenki nyitva a szemét.
  • Mint azt zseniális magyar kutató megjósolni március 7-én: Olaszország egésze problémás sajnos, és ezt most már az ottani intézkedések is tükrözik. Az ott lévő külföldiek még hazamehetnek, úgyhogy lesz itt mire figyelni a visszaérkező magyarok kapcsán is.
  • Gyors intézkedések iskolák, gimnáziumok szüneteltetéséről Szlovákiában többfelé, pl. Pozsony térségében. Jövő hétfőtől a két legnagyobb szlovák egyetem, a Comenius és a szlovák műszaki két hétre szünetet tart.
  • Lengyelországban a Varsói Orvosi Egyetemen beszüntetik az előadásokat (az emberkoncentráció miatt, gondolom) május 15-ig, azaz lényegében erre a szemeszterre, úgy, ahogy van. Más órák tehát mehetnek azért még.
  • Kiváló cikk Élő Anitától a Heti Válaszban. Sok magyar vonatkozás, és az azokkal kapcsolatban felvetett jogos kérdések mellett pl. megerősíti, hogy Olaszországban triázsolnak (előbbre sorolnak) betegeket életkor alapján, mert már kapacitás felett dolgoznak rég. Magyarország kapcsán szóba kerül, hogy a karanténon belüli elkülönítés erősen problémásan (olyan "dájmondprinszesszesen") valósul meg, és ebből a másik cikkből sajnos úgy tűnik, ez a helyzet
  • Ebből a Brookings-szösszenetből tudtam meg, hogy a németek után a franciák és a csehek is exporttilalmat vezettek be orvosi védőfelszerelésekre. Ennyit az EU-s kockázatközösségről :( A kínai Xiaomi cég közben az olaszoknak adott maszkokat.

2020.03.11.

  • Olasz intenzív osztályi adatok az olasz ICU-k (Intensive Care Units) koordinátorától, Giacomo Grassellitől. 55 ICU van bevonva a járvány kezelésébe. Mostanra 700 beteg ment át rajtuk. 65 év a medián életkor, de jutott ICU-ba 20 éves is fiatal férfi is, ahol intubálni is kellett. A triázsnál (egyelőre) csak az eleve súlyosan (krónikusan) beteg kétoldali tüdőgyulladásos pácienseknél merülhet fel, hogy nem nekik juttatnak lélegeztetőgépet valaki javára. További érdekes tapasztalat: az elején viszonylag sok egészségügyi dolgozó fertőződött meg, mielőtt javult volna a teljesítmény a PPE-k (Personal Protective Equipments) használata terén. De azért előfordulnak fertőzések így is. Grasselli reméli, hogy miután megosztották nemzetközi szinten a tapasztalataikat a kórházi rendszerek újraszervezéséről, mások jobban tudnak majd reagálni. Hm. Naiv volna?
  • Gyógyult személy beszámolója a betegség lefolyásáról. Szakaszosan romló lefolyást élt át, tüdőgyulladásig bezárólag. Érdekes, hogy volt náthás/megfázásos szakasz az elején, és már sok ilyet hallottam: a rhinitis előfordulását a COVID-19 esetében általában (és viszonylagosan) ritkának ítélik, de határozottan az a benyomásom, hogy még így is bőven előfordulnak ilyen esetek.
  • Egyre többen mondják a nyilvánvalót az Egyesült Államok esetében, de másutt is alapvető jelentőséggel: az államnak fizetni kell (1) a tesztek költségét, (2) a karanténozás miatt kieső jövedelmet, (3) a kezelés költségét. Máshogyan egy ilyen járvánnyal szembeszállni komolytalan, illetve a társadalom megfelelő mértékű együttműködését áshatja alá.
  • Dél-Koreából egy fantasztikusan jó beszámoló az ott átélt intézkedésekről bizonyos Eugenia S. Lee-től, a Facebookról. Csak részleteket idézek belőle: (1) "Folyamatosan emelték az elvégzett vírustesztek számát, jelenleg napi 15.000, ami példátlan az egész világon. Összesen már több, mint 200.000 tesztet végeztek el. Aztán kitalálták, hogy ne kelljen annyit várni az eredményre, kifejlesztettek saját teszt KIT-et, történetesen ez lett a világon a leggyorsabb, és a legpontosabb."; (2) "drive through virus tesztelő állomásokat hoztak létre minden bokorban, aki szeretne tesztet csak odagurul autóval, nem kell kiszállni, csak lehúzni az ablakot, a védőruhába öltözött szakemberek nyál mintát vesznek, majd az eredményt SMS-ben küldik. Ha pozitív a teszt, akkor befektetik a beteget, lekövetik az útvonalát, fertőtlenítenek, bezárják a helyeket ahol a beteg járt 14 napig a tünetei előtt, erről SMS-t küldenek az adott település összes lakójának"; (3) "A lift, és egyéb gombokat leragasztották vírusirtó fóliával"; (4) "gondolt egy okosat a kormány, és magához vonta a maszkforgalmazást. Három helyen lehet venni, gyógyszertárban, postán, és egy élelmiszer lánc boltjaiban. Azt is úgy, hogy én például csütörtökön vehetek kettő darabot, mert 1969-ben születtem. A gyerek pedig hétfőn, mert ő meg 1996-ban. Minden nap más születési év vásárolhat. Ha ennek ellenére sem jut hozzá valaki, akkor szombaton, és vasárnap megveheti. Személyi igazolvány jogosít a vásárlásra, azt a társadalombiztosítási adatbázishoz kötötték hozzá, így nem lehet kijátszani a rendszert, és mindenki jut maszkhoz"; (5) "Az otthon gyógyulókról a családjuk gondoskodik, ha nincs, akkor a felügyelő orvos rendel ki segédápolót, aki ellátja étellel, miegyébbel."; (6) "A családos emberek családja természetesen kap vedőfelszerelést, hogy ők ne betegedjenek meg, a beteg pedig egy szobát használ, itt a lakások többségében két fürdőszoba van."; (7) "Anyagi segítséget kap a beteg is, és mindenki más is, aki a járvány miatt nem tud dolgozni"; (8) "kórházak előtt felállított sátrak (vizsgálathoz)" (!!!!!). Ha akár csak a 8-as pontot nem látjuk iszonyatosan gyorsan másutt is megvalósulni, akkor egyszerűen nem tudom, miről beszélgetünk.
  • Pompás adatok az iskolabezárások jelentőségéről influenza idején. 
  • Halálozás jelenleg: +604+182 (utóbbi Irán miatt, lásd alább, még napon belül, a dobozos rész után) a március 9-i álláshoz képest.

Komolyan el kell közben gondolkodnom azon, hogy folytatom-e az itteni frissítéseket, és hogy meddig teszem ezt. A folyamatot, ahogyan a SARS-CoV-2-es pandémiává vált, mára gyakorlatilag végigkövettem. Eljutottunk abba az állapotba, ahol a Worldometers.info és hasonló oldalakon elérhető összesített adatok már nem sokat érnek, sem az esetekkel, sem a halálesetekkel kapcsolatban. A járvány által érintett országok többségében nincs igazán komolyan vehető tesztelési politika a járvány átfogó felderítésére (a dél-koreaiak pozitív teljesítménye ezen a téren ezt még láthatóbbá teszi). És van olyan is, hogy egy-egy ország nyilvánvalóan titkolózik, tagad. Közben most már a Facebook apraja-nagyja járványügyi szakértő lett, úgyhogy hiába foglalkozom tíz éve globális közegészségüggyel, mára rendszeres tapasztalat, hogy elmagyaráznak nekem dolgokat a vírusról, a betegségről és a járványról emberek. Szívesen meghallgatok más nézőpontokat, de így nem annyira érzem a saját szerepemet hasznosnak. Február 22-én pl. megírtam, hogy Iránt fertőzött területnek kellene tekinteni, de ez semmit nem hatott, és ennek még itt Magyarországon is jelentősége lett közben. Utóbb engem a jó előrejelző eredményemért senki sem idézett, tehát még utólag sem sikerült elérni, hogy ilyen téren az elemzésem a továbbiakban jobban hasznosuljon. A kutatómunkát persze mindenképpen folytatom, és időnként, eseti bejegyzésekben, konkrétabb kérdések önálló elemzésével jelentkezem majd, ez a terv, valamikortól a következő napokban. Egyelőre azért még csinálom tovább.

Fontos! A kormány közben döntéseket hozott. Iskolabezárások tárgyában a következőt írja a portfolio.hu: "Gulyás válaszából kitűnik, hogy általános iskolák bezárását akkor mérlegelik, ha gyerekeket is megfertőzne a koronavírus. Ilyen megbetegedés azonban Magyarországon egyelőre nincs." EZ ÍGY NEM LENNE JÓ. Nem tudom egyértelműbben leírni. Ezt a szövegrészt kiemelem dobozban. Még újszülött is volt fertőzött, persze nem Magyarországon, de ebből kell kiindulni. Mivel a legfiatalabbaknál jellemzően nem alakul ki súlyos betegség, őket sokkal ritkábban tesztelik, tehát nem az van, hogy nincs eset, hanem hogy kevesebbről tudunk. Itt egy összesítés, amit az általam imént mondottakkal együtt tessék értelmezni. Következésképpen azt kell feltételezni, hogy a gyerekek között nagyon sok aszimptomatikus vagy enyhe eset lehet, és az iskolák bezárásának jelentősége ezért pontosan ugyanúgy nagy, mint egy influenzajárvány esetén, a fertőzés továbbadása szempontjából. Ehhez nem kell várni egy fertőzött gyermekre (akit le is tesztelünk), itt a megelőzés a cél. Kieg.: közben megvan a sajtótájékoztató felvétele, végig tudtam hallgatni, és Gulyás nem azt mondta, amit fentebb írnak, hanem hogy "a gyerekekre kevésbé jellemző a megbetegedés", de azért ez akkor is problémás járványügyi szempontból. Mindegy mennyire betegszenek meg ők, ha utána a nagymama nagyon. Kieg. no. 2.: Az érv, ha jól értem, az, hogy jelen állás szerint az általános iskolákban lévő gyerekek (és a még kisebbek) nem találkoznak külföldiekkel, és akkor náluk még lehet hagyni némi időt, hogy ne vesszen oda a tanévük... De ez végül nem fogja megmenteni ezt a tanévet nekik, ez azért elég egyértelmű számomra a járvány jellegét ismerve, sajnos, ellenben vezethet még iskolához visszaköthető, szülőket, nagyszülőket érintő klaszterhez a későbbiekben. (Ne legyen helyes a következtetésem.)

Közben levontam a tanulságot a fentiekből, és ha továbbra is tehetek potenciálisan hasznos megállapításokat, mint az iménti dobozos részben, akkor inkább folytatom.

  • Egy jó elemzés, mely kvantifikálni igyekszik a készültség és az esethalálozás kapcsolatát, és arra jut, hogy Dél-Korea és "Kína-mínusz-Hubei" az egyik véglet (CFR=0,5-0,9%), az iráni, olasz, Hubei tartományi stb. eset pedig a másik (CFR = 3-5%).
  • Cikk Mulhouse-ról, az eddigi egyik legjelentősebb francia klaszterről (evangélikus keresztény templomi gyülekezet).
  • A nap végére pedig: még a WHO is eljutott odáig, hogy pandémia van; Olaszországban pedig katasztrófa, a mai nap végén 196 halottal, 1028 személy súlyos vagy kritikus állapotban, a lezárás után is egyértelműen növekedési fázisban, ami elvileg eltérés Wuhantól, bár jeleztem már párszor, hogy a kínai adatokkal azért voltak és talán még mindig vannak is bajok. Iránban állítólag 16 ezren vannak kórházban a járvány miatt, miközben az olaszországinál hivatalos szinten jobb helyzetet jelentenek, kereken (!) kilencezer esettel és 354 halottal. E szerint a forrás szerint 900 körül volt március 10-re a halottak száma (+664 az aznapi hivatalos felett, ami semmiképp nem elrugaszkodott a valóságtól, mert március 3-áról volt +482-es adatom, az akkor hivataloshoz képest).

2020.03.12.

  • Donald Trump utazási korlátozásokat vezetett be az európai országokra vonatkozóan. Ez gazdaságilag lose-lose, járványügyi szempontból viszont win-win. A Trump által "külföldi vírusként" jellemzett RNS-szörnyike már éppen eléggé szétterjedt ehhez a pocsolya mindkét oldalán. Az amerikai elnök szerint a SARS-CoV-2-esnek "nem lehet esélye" az amerikai nép ellen. A biztosítóik azért mindent megtesznek egy fair mérkőzés érdekében, és csak a tesztelés társ-költségeit hajlandók átvállalni a biztosítottaktól, a kezelését nem, és így akkor beteg emberek — ha nincs pénzük — nyugodtan fertőzhetnek inkább másokat. A rendszer sajátos logikája azt diktálja, hogy megmenteni önmagát nem gazdaságos.
  • Az elővigyázatossági szabályok betartásának nehézségei. Mark Rutte holland miniszterelnök a kézfogások kerülésére szólít fel, majd kezet fog a mellette állóval. Sara Cody, Santa Clark megye (Kalifornia) közegészségügyi főhivatalnoka a szánk-szemünk érintése ellen figyelmeztet, majd a szájába nyúl.
  • Kína ezer lélegeztetőgépet ajánlott segítségként Olaszországnak. Kétmillió maszkot is. 
  • Ebben az elemzésben van egy ábra (Figure 1), amelyik azt mutatja, hogy a kínai ellátási láncokhoz kapcsolódó input milyen mértékben fontos az egyes európai országok outputját tekintve, és... Magyarország az első helyen: 7,5%-kal. Hollandia, Csehország, Észtország következnek utánunk. Britek, olaszok 3% alatt. Mindennek a jelentőségét relativizálja, hogy Kínában talán hamarosan újraindulhat a termelés, miközben éppen itt lesznek zavarok ezen a téren.
  • Trumptól most olvastam, mit mondott, amikor a CDC-t meglátogatta: “I like this stuff. I really get it. People are surprised that I understand it. Every one of these doctors say: ‘How do you know so much about this?’ Maybe I have a natural ability. Maybe I should’ve done that instead of running for president”. Mondtam én. Minden idők legnagyobb IQ-val megáldott vezetője, nincs menekvés a tény elől.
  • Egy cikk a denevérvírus-kutatók ászáról, a kínai Shi Zhengliről, akit már én is többször idéztem itt! Nem keveset barlangászkodott azért Jünnan (Yunnan) tartományban és másutt, hogy aztán a laboratóriumban és publikációkban is jól teljesítsen.
  • Az olaszországi kórházakban gyakorolt triázshoz ez a szakmai etikai ajánlás született. Elég hátborzongató, mert itt már közvetlenül a túlélési esélyek elosztásáról van szó, életkor, komorbiditások, várható életévek és várható kezelési időtartamigény alapján.
  • Itt áttekinthető az olasz helyzet részletesen, térképen. San Marinóban, Anconában, Rómában és Nápolyban is komoly klaszteresedés Észak-Olaszországon kívül, emellett pedig egyenletes terítés országszerte.
  • Minden bizonnyal csak a jéghegy csúcsa, de további, a járványhoz köthető halálesetekről találtam hírt Kínából. Egy leukémiás hölgyet és egy vesebeteg férfit is elküldtek a kórházak, mert túl nagy volt a fertőzésveszély, és így végül az elővigyázatosság végzett velük. A kezelése elmaradása miatt a nő meghalt, a férfi pedig öngyilkos lett.
  • Halálozás március 9-hez képest: +943+184 (a plusz esetek Kínából és Iránból valók). Felső érték = 6638+n.
  • Az Irán által támogatott Kataib Hezbollah megkatyúsázott egy támaszpontot (Taji) még tegnap, megölve két amerikai és egy brit katonát, megsebesítve tizenkettőt. Garantáltan lesz visszacsapás. Irán vezetői brutális járvány közepette játszanak a tűzzel, megéghetnek.
  • Az írek, a dánok, a franciák (és mások) bezárják az iskolákat. A britek nem. A hollandok is inkább helikopterek. Jeremy Hunt volt eü. miniszter nem ért ezzel egyet, most hallottam a Channel 4-en. Javaslata pl. egy lájtosabb iskolaműködés bevezetése minimálisan — hogy az iskolák pl. vigyázzanak az eü. dolgozók gyermekeire, és közben 95%-kal kevesebb gyereknép koncentrálódjon bennük.

2020.03.13.

  • Ettől tartottam. Nem lehet egy kormányzati politikát (jelen esetben Magyarországon az iskola-be-nem-zárást) tekintélyféltésből tartani. Egy járvány idején az ilyesmi kíméletlenül szankcionálódik a valóság által. Gimnázium, az egyik diák édesanyja fertőzött, de erről inkább nem szóltak volna a diákoknak. A fertőzött nő családtagjait pedig nem tesztelték, mondván, hogy csak tünetek kapcsán lehet tesztelni. AZ KÉSŐ. Muszáj ellőni pár esetlegesen korai tesztet közeli kontaktoknál legalább. Mint a 444 írja: "Az édesanyján keresztül érintett gyerek az utóbbi napokban élte a diákok rendes életét: sportolt, evett a menzán, és ahogy az órarend előírta, vándorolt a tantermek között. A hivatalos szerveknek az az elvárása, hogy mindent pontosan így folytasson tovább, együtt a többiekkel." Ez abszurd. Kieg.: a Toldy gimnáziumról van szó. Update: már tesztelnek.
  • Van viszont magánúton elérhetőt teszt most már.
  • Az olaszországi triázsról írtam fentebb, arra vonatkozóan, ami az intenzív osztályokon történik. De van triázs ennél tágabb értelemben: "Általában egy infarktus miatti telefonhívást percek alatt intézünk. Most egy órát vagy annál többet kell várni. (...) Inkább nem keresek magyarázatot. Azt mondom magamnak, ez olyan, mint a frontsebészet. Csak azokat mentjük meg, akiknek esélyük van. Éppen ez történik most" — mondja egy bergamói aneszteziológus, Christian Salaroli.
  • Törökország viselkedésével kapcsolatban van egy új hipotézisem. Nyilván a szíriai konfliktushoz kötődik az igen rút menekültpingpong beindítása a görögökkel, de mi van, ha ez a koronavírussal kapcsolatos félelmekhez is kapcsolódik? Látják, mennyire segélyre szorulnak majd, és ráadásul van a területükön egy jókora extra sebezhető populáció, amely a járványt fűtheti.
  • Az amerikai visszavágás a Kataib Hezbollah ellen, mely persze gyakorlatilag az iraki biztonsági erők része, és ezért az ellene való fellépés tovább komplikálja az iraki kormánnyal fennálló kapcsolatokat (ha úgy vesszük, "iraki katonai támaszpontokat" kellett hozzá támadni). Mindezt azért érdekes figyelni, mert az eszkaláció elég nyilvánvalóan a járvány sújtotta Iránt is elérheti, tekintve hogy ők csinálták megint a balhét.
  • Jó cikk az iskolabezárások mellett a Portfólión, felhívja a figyelmet az idősödő tanári karra ható kockázatra is fontos szempontként.
  • Két tiroli településre vonatkozóan (Paznauntal és St. Anton am Arlberg) karantén Ausztriában. Emellett egyéb intézkedések.
  • Egy fórumon valaki elkezdte magyarázni, hogy az iskolákat nem is kell bezárni, mert akkor a gyerekek legalább biztonságosan átesnek a betegségen, és immunitást szereznek, és addig sem a nagyszülőkre bízzák őket. A nyilvánvaló válasz részemről: "Szerzett immunitás: koronavírusoknál nem tartós, ezzel ne tessék tervezni. A fertőzésen "biztonságosan áteső" gyerekek: tőlük is R0ⁿ fertőzés indul = nem biztonságos." Viszont az valóban nem jó, ha a nagyszülőkre sózzák a gyerekeket. A középiskolák szerintem minden probléma nélkül bezárhatók ilyen szempontból, mert a gimnazisták magukban is otthon lehetnek, de a kisebb gyerekek esetében a szülőkre is hatni kell, hogy értsék az idősebbekre nézve jelentkező fokozott kockázatot. Hozzátenném viszont, hogy ha most lépünk az iskolákkal kapcsolatban, akkor még nem olyan nagy a kockázat, hogy a gyerekek hordozzák a vírust — és ez a kockázat aztán exponenciálisan nőni tud.
  • Svájc sem tesztel nagyon. Az enyhe eseteket pedig eltanácsolták a kórházi jelentkezéstől. A kínai adatok rosszak voltak éppen eléggé, de itt egyszerűen nincs próbálkozás a felderítésre. A nyugati országok nagy része olyan következetesen kezelte félre a helyzetet, hogy azt nehéz valamiféle elemzési paradigmába illeszteni, hacsak nem Allison jó öreg bürokratikus politika modelljét húzom elő, és az persze elrendezi a dolgokat... Van abban némi irónia, hogy Svájcban van (Genfben) a világjárványt csak március 11-én hirdető WHO bázisa.

2020.03.14.

  • Most már nekünk is van olyan vírusos tüdőgyulladásos esetünk, ahol nyögvenyelősen sikerült utólag kideríteni, hogy az illető koronavírusos, és ezzel kórházi dolgozók és talán mások is ki voltak téve fertőzésveszélynek a János kórházban. Ez ráadásul egy visszakövetetlen eset.
  • A példa arra, miért nem rendészeti feladat normális körülmények között a járványügy. A rendőrök hajlamosak karanténba utalt személyről potenciális bűnelkövetőként gondolkodni, máskor meg éppen indokolatlanul lazán hozzáállni: nehogy már minden kamiont meg kelljen állítani, mindenkinek kényelmetlen az.
  • Fontos cikk a Válasz Online-on
  • Az Egyesült Államokban is hihetetlenül lassan indult be a védekezés, de most már van "drive-up" ("kocsival odahajtós") rendszer, mint pl. Dél-Koreában és Németországban is.
  • Ha Trumpról kiderülne, hogy fertőzött, az aztán érintené az elnökválasztást, de így is van már interakció a két folyamat (a járvány és az elnökválasztás) között: Louisiana elhalasztotta az előválasztásokat. Novemberre alapjukban tudnak megrendülni a dolgok, úgyhogy ez itt ennek a történetnek az első kicsi fejezete.
  • Olaszország egy héten belül elérheti az intenzív osztályi kapacitásmaximumot (ez valójában a fizikai befogadóképességre vonatkozik, a lélegeztetőgépek használatát már jó ideje triázsolni kell). Persze jött közben kínai szállítmány felszerelésekből, de ez már nagyon meredek helyzet.
  • A fertőzésen átesettek tartós orvosi problémáiról, Hongkongból. A tüdők sajnos tartósan károsodhatnak a koronavírus okozta szövetközi tüdőgyulladástól.
  • Komplikációk a Brexit szempontjából. Boris Johnson beleragadhat a befolyás nélküli, fizetős tagságba (és annak kényszerű hosszabbításába), vagy pedig no-deal Brexit lehet az eredmény, a jelen irgalmatlan körülményei között.
  • A vírusrészecskék környezeti túléléséről újabb kísérleti eredmények.
  • Kieg. közben a tegnapiakhoz. Nyilván mindenki tud a miniszterelnöki bejelentésről, hogy az iskolák bezárnak Magyarországon is, pontosabban távoktatásra térnek át, ezzel tehát előrébb vagyunk akkor prevencióban. Maga az oktatási modernizáció ilyen körülmények között persze nem lesz egyszerű, és az "ilyen körülmények" sok mindent jelenthet még az elkövetkezőkben. Megkockáztatom, hogy az egyetemeknek ezen a téren valószínűleg könnyebb dolga van, de lehet, hogy tévedek, meglátjuk.
  • Meghalt az Iráni Iszlám Forradalmi Gárda egyik tábornoka. Érdekes adalék lehet, ha hozzáteszem, hogy Iránban egy csomó konteó kering, miszerint az iráni vezetők csak hazudják a fertőzöttségüket, hogy aztán isteni jóakaratra hivatkozva "gyógyultan" álljanak elő — csakhogy most már többen is meghaltak a vezetés soraiból, szóval ez az elmélet nem annyira tökéletes. Közben pedig ott vannak a komi tömegsírokról készült műholdfelvételek. Az a minimum, hogy Olaszországnál rosszabb ott a helyzet.
  • A svédek is elengedték az átfogó adatgyűjtés, a kapcsolatkövetés és a széles körű (enyhe esetekre is kiterjedő) tesztelés igényét. Megdöbbentő. A korlátozó intézkedéseknek csak ezekkel együtt van értelme. Ezek nélkül nincs, hiszen nem lehet leállítani az életet a végtelenségig, ha a járvány megfékezéséért közben nem dolgozunk egyéb eszközökkel is. Ezt tényleg olyan nehéz megérteni?

2020.03.15.

  • Orvosi beszámoló az Egyesült Államokról egy esetről. Páciens (középkorú nő) bejön, köhög, láza van, légszomja, járt másik országban is, ahol járvány van (mármint az USA-n kívül ugye, ahol nyilvánvalóan szintén járvány van), és a tetejében HIV-pozitív. Le kellene tesztelni. Csakhogy már a tüneteinek az "enyheségére" hivatkozva is simán elutasítják. Hubei tartomány és közvetve a kínai rendszer felelős azért, hogy a járvány ott, a kezdetek kezdetén úgy felrobbant. De Nyugat-Európa és Észak-Amerika országainak jelentős része elképesztő módon áll hozzá a kérdéshez, miközben Kína extrém intézkedésekkel nyert (nekik is) másfél hónap időt... Az "engedjük el" megközelítést másfél hónappal ez előtt is lehetett volna alkalmazni simán, az nem olyan nehéz.
  • Az imént idézett cikkből: "as of March 11, the United States had performed only 23 tests per million people, while the U.K had performed 347 per million, Italy 826 per million, and South Korea 3,692 per million."
  • A kezelés terén egyébként mostanra látszik, hogy vannak hasznos dolgok, persze nem varázsszerek, és nem feltétlenül együtt használandók, mert egy részüknél kellemetlen interakciók alakulnak ki: pl. choloroquine cinkkel kombinálva (beviszi a cink-iont a sejtekbe a sejtmembránon át, és akadályozza a vírus reprodukciós folyamatát az ahhoz szükséges RNS-dependens RNS polimeráz (RdRp) blokkolásával); hydroxychloroquine, a kísérleti Remdesivir stb.
  • Friss hír, hogy a francia orvosok nem javasolják pl. az ibuprofen szedését (az Algoflex hatóanyaga), mert csökkent immunválaszhoz vezet a lázcsillapító hatással. Ezt kicsit bizonytalannak érzem, és nyilván kellene valamilyen klinikai adat, ha láttak szignifikánsnak tűnő kedvezőtlen hatást. Felvetődik pl., hogy ha volt ilyen, az nem függhet-e össze azzal, ahogyan az ibuprofen a szívet, májat, veséket megterheli, azokat a szerveket, amelyekre a koronavírus is nagyon rossz hatással van. Az asztmára is rossz hatással lehet az ibuprofent, az pedig a COVID-19 betegségnél szignifikáns komorbiditás.
  • Közben Facebookon értesültem arról, hogy továbbra is érkeznek turistabuszok Olaszországon át francia síelésből és hasonló helyekről, minden különösebb ellenőrzés nélkül. És közben hozzá ott a hír, hogy a koronavírus-tesztelést végző magánlabort megrohamozták az emberek. Úgyhogy itt az ideje egy kiadós figyelmeztetésnek. 1: A labor számára: tessék felelősen elmagyarázni ezeknek az embereknek, hogy a negatív tesztjük semmit nem ér, ha még egy hétig inkubálódik bennük a fertőzés, mert épp csak beestek a hazaútról. 2: Az emberek számára: lásd az 1-es pontot, amennyiben ezt nem magyarázza el nektek valaki magától.
  • Közben már az is látszik, hogy az Olaszországból hazaáramlottakkal jöhettek fertőzöttek feltehetően szép számmal. Az új fertőzöttek között is vannak Olaszországból érkezettek.
  • Még pénteken, biciklinyeregből, munkaügyben elsuhanva tapasztaltam, hogy a napsütés és az "izgis, szabadabb" időszak sokakat kihajtott az otthonukból kávézókba, éttermekbe, napos placcokra. Ez sajnos így nem social distancing, és ezt még megbánhatja mindenki. Ahelyett, hogy tartósan ki lehetne járni szükségetalapon, az elején elronthatjuk a helyzetet annyira, hogy aztán már egy mély levegőt szívni sem lehet kimenni az utcára. Nem szeretnénk ezt. Kerüljük a tömegeket.
  • Más: Thaiföldön háború tört ki majombandák között az elmaradó turisták, illetve pontosabban az elmaradó ajándékfalatkák miatt.

A nap térképe: egy Proxi.cloud nevű cégtől, akik lengyel mobilappok támogatására csinálnak adatszolgáltatásokat. A felhasználók megoszlása, akik ezeket a lengyel appokat használják, és az olasz zéróbeteg jelentkezésének helyén és idején beloggoltak. Így terültek szét azóta. A térkép lengyel változatán látszik, mennyire inkább Dél-Lengyelországból jellemző az olasz meló. És persze hozzátehető, hogy itt lengyel mobilappokról van szó, tehát más appok kapcsán más földrajzi szétoszlás képét kapnánk.

proxicloud_spread_of_users_who_logged_in_whereitalianpatientzerowas.jpg

  • Az Egyesült Királyságban hangzott el a napokban az a közveszélyesen őrült kijelentés, miszerint a fertőzések révén kell biztosítani a nyájimmunitást a brit populációnak... a fertőzesek ellen. De azért értelmes dolgok is történnek ott a felkészülés jegyében. A sok szállodai lemondás nyomán egyes szállókat át lehet alakítani szükségkórházzá, különféle vállalati gyártósorokat pedig lélegeztetőgépek előállítására lehet használni, ezzel terveznek, egyebek mellett.
  • Egy jó anyag a koronavirus.gov.hu-n. A "kapcsolatvizsgálat" menetéről (kapcsolatkövetés, contact-tracing). Alacsony kockázatú és magas kockázatú kontaktokat különböztetnek meg a karanténozás szükségessége tekintetében. Alacsony kockázat pl. 15 percnél rövidebb interakció tünetmentes fertőzöttel. Magas kockázat pl. egy háztartásban élni vagy közvetlenül érintkezni fertőzöttel, pl. orvosként megfelelő PPE nélkül kezelni fertőzöttet, vagy utasként két ülés távolságon belül ülni fertőzöttől közlekedési eszközön.
  • Egyelőre kérdéses, hogy sikerül-e mindenkinek törvényi úton biztosítani a fizetett betegszabadság lehetőségét az Egyesült Államokban. Értelmesebb vállalatok persze törvénytől függetlenül ajánlanak már ilyen opciót. Nyilván nem éri meg egy cégnek sem munkába kényszeríteni beteg vagy potenciálisan fertőzött alkalmazottat, hogy aztán még többen essenek ki miatta, és — pl. egy étterem esetében — még a reputáció is helyrehozhatatlan károkat szenvedjen.
  • Aszimptomatius transzmisszió témában érdekes egy massachusettsi klaszter: a Cambridge (MA) bázisú Biogen biotech cég egy nagy értekezlete után három embernek lett pozitív tesztje, és ez mostanra 80+ esethez vezetett — a három érintett tünetmentes volt az értekezleten.
  • Az Iszlám Állam kicsit komolytalan, de még ezzel együtt figyelemre méltó módon a fertőzött területek, pl. Európa elkerülésére inti harcosait.
  • Közben van már magyarországi áldozat. Egyike a "semmiből felbukkanó" virális tüdőgyulladásos eseteknek, szóval innentől tessék mindent nagyon komolyan venni. Két halott mellett, 2%-os, átlagos CFR-t feltételezve, amit általában valamennyi enyhe eset elkerülhetetlen figyelmen kívül hagyása mellett sikerül kimutatni, ez 100+ fertőzöttet sejtet Magyarországon.
  • Valójában ugyanis nem a mai volt az első áldozat. Ugyanis itt van ez a másik eset, ahol gyakorlatilag egyértelműen koronavírus-fertőzés volt az ok. "Tüdőgyulladásban meghalt egy idős nő a budapesti Szent Imre kórházban. Az elhunyt aszsony lányát koronavírussal kezelik a Szent László kórházban." Így akkor +1 esetet kell könyvelnem a halálozások számításánál, ezúttal magyarországi eset miatt (korábban Thaiföldről, Olaszországból és Kínából is volt ilyen, nem regisztrált, de erős valószínűséggel dokumentálható eset).
  • Muszáj lesz több laboratóriumnak megengedni a PCR-tesztek végzését. Különben csak rövid távú előnyt adnak, és végső soron a gazdaságot pusztítják a korlátozó intézkedések.
  • A kormányzati kommunikáció Kovács Zoltán szóvívő részéről "támadva-sértődötten védekezős" volt ma — most néztem a sajtótájékoztatót. Nem szerencsés hosszú távon. Itt egy társadalom együttműködését kell biztosítani válsághelyzetben, így ez a stílus nem jó. Újságíróknak javasolni tudom, hogy lehet esetleg előre egyeztetni a kérdésekről, amelyekre mindenképpen választ szeretnének kapni, és akkor nem számít olyan sokat, ha továbbkényszerítik a mikrofont annak a kezéből, aki tudni akar valamit. A kormányzatnak pedig azt javasolnám, hogy meg lehet szabadulni az Atlasz-komplexustól, mert itt nem csak retorikailag, hanem TÉNYLEG szükség lesz minden ember együttműködésére — nem egyvalakinek kell viselnie a Hatalmas Felelősséget. TÉNYLEG nem volna baj, ha a társadalom részletes ismeretekhez jutna az egyes esetek hátteréről.
  • Ha Dél-Koreának sikerült kemény korlátozó intézkedések és a társadalmat passzivizálni igyekvő kormányzati megközelítés nélkül megtörni a járvány logaritmikus növekedését, akkor talán európai demokráciákban is lehetséges volna.
  • Szenzációsan jó szimulációk mutatják itt a free-for-all, a social distancing lite + hard és a karanténozós megközelítések relatív hatékonyságát, a social distancing javára.
  • Globális halálozás március 9-hez képest: +2152+185 (a plusz esetek nagyrészt Kínából és Iránból valók). Felső érték = 8048+n.

2020.03.16.

  • Ilyenkor van, hogy biology fucking blows my mind. A ciklezonid nevű inhalációs kortikoszteroid (asztmagyógyszer) jól akadályozza a SARS/MERS jellegű humán koronavírusok replikációját, jelentik japán kutatók egy még review-nak alá nem vetett tanulmányban. Aminek lehet gyógyászati jelentősége, de közben... "After the eleventh consecutive MERS-CoV passage in the presence of ciclesonide, a resistant mutation was generated, which resulted in an amino acid substitution (A25V) in nonstructural protein (NSP) 15, as identified using reverse genetics. A recombinant virus with the mutation was also resistant to ciclesonide suppression of viral replication."
  • A járvány és a társadalmi egyenlőtlenségek súlyosbodása (NYT). 114 ezer hajléktalan diák csak New York városban (NYC), akik most elesnek napi egy melegétkeztetéstől az iskolabezárások nyomán, például (az iskolai étkeztetéssel kapcsolatos probléma Magyarországon is adott). Egy jó policy paper arról, hogyan befolyásolta ez a dinamika a H1N1-es járványt annak idején (2009-2010).
  • Az afrikai kilátásokról. Dél-Afrikában pl. HIV/TB-klaszterek a járvány útjában, potenciálisan, zsúfolt nyomornegyedek, és kontinens-szerte nagyon gyenge eü. rendszerek. Dél-Afrikában áprilisban kezdődik az ottani influenzaszezon.
  • John Oliver megint kötelező néznivaló. Többek között azt az izgalmas kérdést is körüljárja, hogy Rudy Gobert NBA-kosárlabdázó vagy Donald Trump voltak-e hülyébbek az elmúlt héten, és ez egy nehéz kérdés, mert mindketten kitettek magukért. Gobert például kézrátéttel terjesztette a vírust, viccből.
  • Az Egyesült Királyságban egy kikerült belső szakpol anyag 7,9 millió hospitalizációt helyez kilátásba 2021 tavaszáig. Kínomban ismét csak azt tudom mondani, hogy ez alaptalan riogatás, hiszen nincsen ennyi kórházi hely.
  • Dél-Koreában ennyire torzítja az adatokat a kor szerinti megoszlás eltérése, ami részben a Shincheonji egyház tagságának átfertőződéséhez köthető. Megkockáztatom, hogy az olasz és a dél-koreai idős emberek közötti különbség az időskori elmagányosodás különböző mértékéből is fakadhat. Az olaszoknál megy a dominózás, társas élet idős korban is. Persze ez így csak hipotézis, majd kicsit jobban utánaolvasok. Mindenesetre nagyon érdekes, hogy míg 17,2% Olaszországban a 70 év felettiek aránya a populációban, a megerősített fertőzések között 41,3%-os a részesedésük. Ez brutális felülreprezentáció, miközben Dél-Koreában alulreprezentáció van! Dél-Koreában a 20-29 éves korosztály a populáció 13,3%-a, a fertőzötteknek pedig 29,9%-a, ott ők a felülreprezentáltak. Persze a korszerkezet mellett az eltérő tesztelési politika is tényező, azt nem szabad elfeledni.
  • Izgalmas, már eredményekkel kecsegtető kutatás Hollandiában SARS-2-es ellen alkalmasnak tűnő antitestek gyógyászati előállítására. Persze antitestek a gyógyult emberek véréből is nyerhetők, de az jóval problémásabb forrás, ha nem akarjuk őket túlterhelni akkor, amikor a poszt-szimptomatikus állapot még sok rejtelmet tartogat orvosilag (Kínában mindenesetre tömegesen használták ezt a megoldást is).
  • Ez alapján a hír alapján tényleg megkockáztatom, hogy Trump szellemileg leépülőben van. Az ötlete ronda is ÉS hülyeség, egyszerre (ajánlat exkluzív jogok vásárlására egy vakcina kifejlesztőjétől).
  • Hollandiában az intenzív osztályon kezeltek fele 50 év alatt. Franciaországban az ICU-kban kezeltek fele 60 év alatt.
  • Globális halálozás március 9-hez képest: +3066+185 (a plusz esetek nagyrészt Iránból, és azon kívül Kínából és Magyarországról valók). Felső érték = 8760+n. (ALSÓ ÉRTÉK = 7069+10+2+19=7099. FELSŐ ÉRTÉK = 7069+3+1000+664+3+1+1+19+n = 8760+n.)

2020.03.17.

  • Meglehetősen adatszegény közlésből tudjuk a koronavirus.gov.hu-ról, hogy 50-re nőtt a regisztrált fertőzések száma. Hogy az esetek hátterét adatvédelmi okokra hivatkozva nem közlik, az röhej. Epidemiológiai szempontból abszolút nem érdekel a fertőzötteknek semmilyen személyes adata. A demográfiai jellemzőik viszont igen. Az érintett területek és intézmények pedig közérdekű információ, jó napot kívánok.
  • Az Egyesült Államokban két sürgősségis orvos is súlyos állapotban, intenzíven, egyikük negyvenvalahány éves.
  • A kínai Alibaba cég maszkdonációkkal segít az Egyesült Államoknak. Tesztkiteket is adnak, pl. Afrikába. 500 ezer maszk a belgáknak is. Ez nagyon klassz dolog, de az érintett nyugati országok egyébként tehetősek és fejlettek — pontosan miért is nem tudnak gyári kapacitásokat maszkok termelésére állítani? Jó napot kívánok ismét.
  • A Franciaországból, Németországból, nyugatról hazafelé tartó bolgár és román forgalmat átengedik az ország területén, miután feltorlódtak a határon, ahol nem engedték át őket, és már fogytán volt a vizük-élelmük.
  • Sok pozitív dolgot elmondtam Kínáról itt (is) eddig. Nagyon sok minden tetszett, amikor ott jártam korábban. Viszont amit a kínai külügyminisztérium művel, az felháborító. Ezek a tisztviselők nem éreznek szégyent? Miattuk halnak meg a világban emberek jelenleg exponenciálisan növekvő számban, miközben ők konteókat terjesztgetnek, pont azért, mert tudják, hogy felelősek ezért (a rendszer teljesítményén és eltussolási hajlamán keresztül) legalább közvetve. (Én korábban elítéltem itt minden más konteózót is, köztük amerikai politikusokat is — de minőségileg más, és egy nagyságrenddel rondább, amikor egy baleset felelőse terjeszti, hogy valójában minden a mosómedvék miatt volt.) A motivációjuk részben az amerikai elnöki adminisztráció aktuális diskurzusából származik — kínai részről bevett eljárás az ilyesmit rasszizmusként megbélyegezni, és az Egész Kínai Nép nevében megsértődni, de közben azért látni kell, hogy a SARS-CoV-2 Wuhanból, Kínából indult, szóval akkor a "wuhani vírus" pl. aligha borzasztóan pontatlan leírása a kórokozónak, amelyről nagyon nehéz dinamikus élőbeszédben "szárszkovkettőként" megemlékezni, pláne laikusoknak. 
  • A koronavírus-járvány pozitív hatásai rovatban kaphat helyet, hogy még Gabonban is kevesebb tobzoskát esznek meg most már az emberek.
  • Forgatókönyvek egy virológustól. Az ő véleménye = Gyors rendezés májusig: optimista változat. Rendezés júliusra-augusztusra: legvalószínűbb változat. Újra-felbukkanás decemberben = legrosszabb, legkevésbé valószínű. Szerinte.
  • Megy közben a médiában egy csomó hír vakcinatesztelések megkezdéséről. A tesztelés lesz a lassú, ezt nem ártana hozzátenni az emberek informálására. A tesztelést nagyon komolyan kell venni, nem lehet siettetni, mert ha itt valami hiba történik, és az átoltás nem hatásos, az egyrészt emberéleteket követelhet, másrészt akkor innentől végképp minden hülye kerülni fogja az oltásokat, és jön értünk a kanyaró. Meg egyéb, más kórokozók.
  • Fegyvervásárlási hullám az Egyesült Államokban, korrelálni látszik a fertőzések általi érintettséggel (Kalifornia, NY, Washington).
  • Szalai Máté kollégám Irán és az IMF tárgyalásáról és az országnak esetlegesen jutó 5 milliárd USD segítségről.
  • 3D-nyomtatott lélegeztetőgép-alkatrészek (szelepek) Olaszországban. A 3D-nek amúgy is nagyon érdekesen alakítja a jövőjét ez a most következő gazdasági válság. Az egyik alapvető válasz lehet a transznacionális ellátási láncokkal kapcsolatos elbizonytalanodásra.

2020.03.18.

  • Faktorok Tajvan sikerében a járvány elleni fellépés terén. A kommentek között rdos linkelt remek cikket a témában. Ez említi a következőket: világviszonylatban nagyon erős orvos-nővér/populáció arány, proaktív intézkedések, a SARS-szal kapcsolatos intézményi hagyaték és memória, megfelelő maszkkészletek, a populáció maszkkal való ellátásának gondosan kialakított, túl- és felvásárlást megelőző rendszere stb. Nagyon érdekes, hogy egy tajvani orvosdelegációnak Peking terepszemlét engedélyezett január elején — akkor, amikor a saját népének a kínai vezetés még nem kívánta teríteni az információkat. Ehhez még hozzá pár dolog: (1) a populáció 99%-át lefedő egészségbiztosítás; (2) még tavaly Kína beszüntette az egyéni turizmust a romló "szoroson általi" kapcsolatok miatt, és ez alighanem jelentős könnyítés volt, mert így nem utazott be annyi fertőzött (előtte, 2016-ban már limitálták a csoportos turizmust). Itt van egyébként jó ábra a tajvani járvány terjedési láncolatairól. Ja, és még valami: egyetlen halálesetük volt. Valamit a kezelésről is tudhatnak, úgy tűnik (ennek még utánajárok majd).
  • Így is lehet nézni a halálozást, ha a környezetre gyakorolt pozitív (légszennyezés-csökkentő) hatását nézzük a járványnak: "The two months of pollution reduction, Burke calculates, has probably saved the lives of 4,000 children under 5 and 73,000 adults over 70 in China" (Marshall Burke, Stanford). Kb. 10 10ug/m3 csökkenésről van szó PM2.5-ös finompor tekintetében Kína-szerte. Peking, Sanghaj, Csengdu és Guangzhou adatait nézve ez 15-17ug/m3-es csökkenés. Itt az eredeti elemzés. Megjegyzem, hogy mortalitásredukciót eredményezhet kevesebb autóbaleset is, és még sok minden, ami az otthonmaradással elmarad.
  • Svájcban is kezd beütni az egészségügyi krach, hacsak kemény intézkedésekkel nem hárítják a már beindult esethullám ostorcsapását.
  • A Worldometers.info-n követhető a súlyos esetek számának alakulása pl. Albániában, Szlovákiában vagy Örményországban, nem követhető viszont Magyarországon, ahol Müller Cecília országos tisztifőorvos ma azt mondta, hogy van két súlyos eset, és amúgy Szlávik doktor úr tudja, hogy mennyi van éppen. A világ viszont nem tudja, pedig egy járvány globális követésénél ez is fontos. Kieg.: március 19. óta már láthatók ezek az adatok.
  • Új nap, új kutatás, új eredmények, régebben is kutatott téma. Itt is többnaposnak találják az új koronavírus túlélését pl. acél és műanyag felületeken (rézfelületen csak 4 óra). Újdonság, hogy itt aeroszolos veszélyt is találtak, néhány órás időtartam erejéig (ha stimmel, nem jó hír). 
  • Iránt sáskajárás is sújtja.
  • Olaszországban, Vo' Euganeóban gyakorlatilag leszűrték az ottani populációt, mint anno a Diamond Princess hajó utasainak nagy részét is. A La Repubblica Sergio Romagnani immunológust idézi, miszerint az eseteknek akár 50-75%-ában is aszimptomatikus lehet a lefolyás (és ugyanakkor abszolúte fertőzőképes az érintett személy). Ha ez így volna, az forradalmi lenne a levonható stratégiai következtetések tekintetében is (mert pl. a populáció sokkal gyorsabb átfertőződését vonná maga után, nehezebb a feltartóztatás stb.), úgyhogy szeretném látni ezeket az adatokat kicsit komolyabb formában is.
  • Egy jó cikk Mongóliáról, bár kicsit könnyelműen kezeli a "még sehol sem volt a probléma, és — bezzeg ők — készek voltak cselekedni" érvet. Más ez Mongóliában, Kína területi szomszédjának esetében, akkor, amikor a nagy ismeretlenbe ugrott éppen fejest a világ anno. Most már több adatunk van, és azt is látjuk, mit tesz a gazdasággal a leállás. Mi több, nem biztos, hogy ha mindenki leáll, az olyan jó lesz a populáció biztonsága szempontjából. A Nagy Leállásnak akkor van értelme, ha a járvány lehető leghamarabb történő felszámolásáért lépések történnek.
  • Globális halálozás március 9-hez képest: +4270+185 (a plusz esetek nagyrészt Iránból, és azon kívül Kínából és Magyarországról valók). Felső érték = 9964+n. (ALSÓ ÉRTÉK = 8273+10+2+19=8304. FELSŐ ÉRTÉK = 8273+3+1000+664+3+1+1+19+n = 9964+n.) A hivatalosan regisztrált halálesetek száma több, mint kétszeresére nőtt március 9. óta.

2020.03.19.

  • Kaptunk bejelentést, hogy 73-ra nőtt a fertőzöttek száma. Hogy honnét valók ezek az esetek, azt továbbra sem kell tudni, úgy optimális, ha pl. Árkodapátiban paráznak az emberek 0 eset mellett, Kecerakoncán pedig mindenki éli az életet, miközben 50% fertőzött. Köszönjük szépen. Akit mégis érdekel ez-az, itt ez a térkép, open-source munka a nyilvánosan elérhető információkból (h/t 2 rdos).
  • Egy olasz-amerikai család sorsa New Jersey-ben. Sokan súlyos betegek, hárman meghaltak, ötvenes éveikben lévők is.
  • Érdekes adatok (Pew Research) a média- és hírfogyasztási szokások és a COVID-19-cel kapcsolatos hírek követésének mértéke közötti összefüggésről. Lehet állítgatni, mire kíváncsi az ember. Nagyon határozott következtetés nem fogalmazódott meg bennem, de érdekes pl., hogy a hírek követéséhez nagyrészt társadalmimédia-platforomokon át jutók valamivel kevésbé követik a járvány alakulását. Republikánusok-demokraták között nincs nagy különbség ebben. Jó lenne látni a különbséget pl. a Facebook és a Twitter között ebben a tekintetben (pl. merafészbukhülye; a napokban a Journal of the American Medical Associatio (JAMA) egy cikkéhez megosztott linkemet is törölte az ámokfutó algójuk, amelyik a home office-ozó és adatvédelmi okokból a kezelőrendszerhez hozzá nem férő embergárda miatt szabadulhatott el).
  • Törlesztési moratórium banki hitelekre nálunk. Azért a kamat gyűlik majd közben, jelen állás szerint úgy tűnik.
  • Sátrak. Itt is. 16-i hírek, még nem osztottam itt meg őket, de fontos fejlemények. Jó.
  • Ruhagyári gyártói kapacitás maszkok termelésére állítva nálunk. Jó!
  • Mellesleg: az 1848-1849-es szabadságharc idején nők készítettek sebkötözéshez használhatő kötszert alsóneműtépetekből. Ma varrókörökben foglalkozak maszkok készítésével, és a You Tube-on is tanítják ezt.
  • A nap kérdése: kreatívan könyvelnek-e a németek? A franciákhoz és az olaszokhoz képest is alacsony a regisztrált esetek és a halálozások aránya náluk. ITA: 2978/35713. FRA: 256/9134. GER: 28/12343. Ekkora különbséget mivel magyarázzunk? A német Übermensch? A német páciensek legyőzik a kórokozót, amellyel mások nem tudnak megbírkózni? Vagy az orvosaik ügyesebbek ennyivel? Vagy csak nem számolják a fertőzés mellett komorbiditással (diabétesszel, rákkal, szívproblémákkal) elhalálozó betegeket? Izgalmas kérdés, ugye. Mindenesetre az olasz arány nem nézne ki sokkal rosszabbnak, ha kivonnánk belőle a komorbiditással elhalálozottakat. Már a WHO is érdeklődik (szelíden), hogy "valódiak-e" a németországi adatok.
  • Egy nővér beszámolója saját betegségéről, az Egyesült Államokból (Akhink Omer, Nashville). Félelmetes, hogy az első orvos, akivel találkozott, nála is antibiotikumot írt fel, és egy bő hétbe telt, mire hajlandók voltak tesztelni. Addigra jóval rosszabb állapotba kellett kerülnie, és így végül az eü. rendszert is jobban leterheli. A korai tesztelése az enyhe és az enyhének hitt (később pedig súlyosbodó) eseteknek védi az eü. rendszert.
  • Velencében újra tiszták a csatornák, kisebb rajtuk a forgalom. Visszatértek a delfinek (erre Douglas Adams is azt mondaná, hogy jó hír). Kieg.: erről közben kiderült, hogy a források megfelelő ellenőrzése nélkül továbbadott hír volt, szardíniai delfinekről. Nem baj, Douglas Adams nekik is örülne.
  • Tartós következmények az akut légúti distressz szindróma folyományaként: előforduló késleltetett halálozás,  illetve a központi idegrendszer és a perifériás izmok károsodása. A kezelés részeként gyakran szükségessé váló intubálás önmagában is tartós következmények forrása.
  • Marcello Natali, egy 57 éves olasz orvos halt meg ma COVID-19-ben. Kersztyű nélkül kellett dolgoznia, elfogyott a felszerelés.
  • Ez a videó nagyrészt Dél-Koreáról szól, de meg lehet nézni benne, hogyan csinált magából hülyét a spanyol eü. minisztérium részéről Fernando Simón. Ezek a tisztviselők nem kevesebbet csinálnak, mint hogy berúgják a labdát a saját kapujukba, miközben mindenki kiabál nekik, hogy ne tegyék. Never go full retard, hogy egy klasszikust idézzek. De tényleg. Minek kiállni, és elmondani, hogy "semmi pánik, ma nem fog lemenni a nap"?
  • A járványnak a mezőgazdasági termelésre gyakorolt hatása. Azok az ágazatok szenvednek első körben, ahol a keresletcsökkenés jelentkezik. Például a bárányok húsának vagy éppen a repceolajnak a beszállítása mind érintett, és még egyebek is.

Fontos: a 444-en megjelent egy összefoglaló egy online beszélgetésünkről Garamszegi László ökológussal, melyre a Rajk László Szakkollégium szervezésében került sor. Világviszonylatban, összehasonlító és ökológiai perspektívából néztük a kérdéseket. A 444 a számba adott mindenfélét, ráadásul idézőjelek között (!), amiket nem mondtam, többek között a magyar kormányról. Kértem a helyreigazítást vagy a cikk törlését, azonnali jelleggel. Itt (a Facebookon) hallgatható meg az eredeti beszélgetés, mely nem a magyar kormányról szólt.

KIEGÉSZÍTÉS: tételes helyreigazítást közöltek.

2020.03.20.

Nagyon szívesen publikálnék ma is sok mindent itt, de részben a 444 fenti kihágásai miatt, részben rendkívül bürokratikus természetű egyetemi feladatok miatt a nap nagy részében le leszek kötve. Azért egy pár dolgot megosztok itt majd addig is.

  1. Belgiumban crowdfundingra szorul az egyik legjobban felszerelt kórház, hogy lélegeztetőgépekkel el tudja látni az érkező eseteket.
  2. Kínában zéró új helyi esetnél tartanak, már ha minden igaz, de közben jönnek haza pl. menekülő jelleggel külföldön tanuló diákjaik és mások, akik fertőzöttek lehetnek (sőt rendre kerülnek is ki közülük fertőzöttek), pl. az új epicentrumból, Európából.
  3. Két újabb magyarországi haláleset. Ezzel összesen négy (egy napokkal korábbi eset miatt +1 a hivataloshoz képest).
  4. Újabb beszámoló betegtől, egy 22 éves nőtől. Ronda alattomos egy betegség ez, a bejegyzések alapján csak remélni tudom, hogy tényleg gyógyulóban van a hölgy, és nem épp a tüdejére megy rá a fertőzés.
  5. Térkép a brit esetek területi eloszlásáról. Walesben valami relatíve nagyobb kitörést eredményezett.
  6. Olasz kórház belülről. Érdemes megnézni, milyen eszközöket használnak, hogy a pácienseket oxigenizálják.
  7. Át kell gondolni az Európán belüli ellátási láncok működését az új helyzetben, mert ezek nem-működtetése nem opció.
  8. Távlatokban gondolkodás arról, hogy mi jön a válság után. Akar lenni. Annyira merész dolgokkal azért nem találkoztam itt. Astra Taylor, egy filmrendező az első, akitől szívesen emelek ide valamit: "All along, evictions were avoidable; the homeless could’ve been housed and sheltered in government buildings; water and electricity didn’t need to be turned off for people behind on their bills; paid sick leave could‘ve been a right for all workers; paying your mortgage late didn’t need to lead to foreclosure; and debtors could’ve been granted relief. President Donald Trump has already put a freeze on interest for federal student loans, while New York Governor Andrew Cuomo has paused all medical and student debt owed to New York State. Democrats and Republicans are discussing suspending collection on—or outright canceling—student loans as part of a larger economic stimulus package. It’s clear that in a crisis, the rules don’t apply—which makes you wonder why they are rules in the first place." Theda Skocpol pedig megmondja, hogy a járvány a társadalmi egyenlőtlenségeket jó eséllyel növelni fogja. A többiek, akik hozzászólnak, sok pozitív dolgot mondanak, ami nem baj, csak nem feltétlenül reális.

2020.03.21.

  • Ennek a járványnak a közegében minden képlékeny. Dél-Korea továbbra is jó példa számos tekintetben, de az elmúlt hetek biztató eredményei után nekik is komolyabb korlátozó intézkedéseken, social distancingen kell most gondolkodniuk
  • Egy cikk a szerzett immunitásról, hogy lehet-e rá számítani a fertőzésen átesve. Lelövöm a poént. A cikkben kb. egy tucatszor szerepel, hogy we don't know. Because we don't know. Because we can't tell at this point.
  • Elborzasztó adatok a kezelés számlázott költségeiről az Egyesült Államokban. 34927 dolláros kezelés, melynek a szisztemikus félrekezelés is a része természetesen: hogy egy hétig romlik valaki állapota, mielőtt tesztelnék, aztán még három nap, míg megvan az eredmény, és akkor végre kap esetleg célzott kezelést. Így nagyon sokan fognak meghalni.

A Google ma Semmelweis Ignácra emlékezik, aki persze a gyermekágyi láz megelőzésében játszott szerepéről ismert, de a koronavírus-járvány kontextusában most általában a kézmosás védőszentjeként köszön vissza.

semmelweis.jpg

  • Suzuki. Gyorsan megválnak 400-600 munkaerő-kölcsönzős megoldással alkalmazott munkavállalótól Esztergomban.
  • Érdekes megemlékezés a poliovírus okozta járványról. Van olyan boomer generációs ember, akit annak idején gyermekként-unokaként féltettek, ma pedig nagyszülőként éli át ugyanezt, idézik a cikkben. A COVID-19 és a polimyelitis nyilván egészen más betegségek egyébként, de eszembe jut erről hasonlóságként, hogy mindkét esetben egy apró kisebbség számára járnak ezek borzalmas következményekkel, míg az eseteknek egy jelentős százalékában aszimptomatikus a lefolyás.
  • Osztrák sógoraink szerepe sem elhanyagolható immár az európai SARS-2-járvány történetében. Ischgl városa és a közeli síkomplexumok + Tirol kitettek magukért. Norvégia, Izland, Németország és mások mind rengeteg esetet kaptak erről az egy helyről (a norvégok pl. 1400-ból 40%-ot!). Azt a tiroli tisztviselőt, aki a nyilvánvalóról értesülvén pókerarccal elmondta, hogy "orvosi szempontból valószínűtlen, hogy mind itt fertőződtek volna meg", remélem, felelősségre vonják egyszer alaposan. 

Mivel a jövő héttől következik nekem az eléggé munkaintenzív online oktatás, itt fogom abbahagyni a járvány követését. Konklúzióként azt mondanám el, hogy ha nem teszteljük az enyhe eseteket, és náluk nem végezzük el a kapcsolatkövetést, az semlegesíti a korlátozó intézkedések hatását a járványra. Ez jelenleg az európai országok mindegyike számára releváns figyelmeztetés (és éppenséggel az Egyesült Államok számára is), mivel nagyjából mindenhol az enyhe eseteket önelkülönítésre hazaküldő, őket figyelmen kívül hagyó megközelítést követik jelenleg. Rossz látni, hogyan maradt a járvány terjedéséhez mindig nyitva egy-egy kiskapu. A legtöbb európai országban eleinte nem tesztelték azokat, akik nem Hubei tartományból érkeztek, vagy nem ismertek egy fertőzött személyt. Most pedig a legtöbb országban már csak a súlyos eseteket tesztelik. Miközben ennek a kórokozónak a terjedéséhez egy rossz mozdulat, pl. egy szemdörzsölés is elég, egy érintett tárggyal való kontaktot követően. Ennek a kórokozónak tehát nem kellene ilyen esélyeket adni.

Ha az elemzésemmel tudok fontos javaslatot megfogalmazni, megteszem majd külön posztban ez után is, fentebb.

Na jó, és még egy link, mivel most már senki nem fog hülyéskedni ezzel kapcsolatban, remélhetőleg. A csehek okkal váltottak a maszkok propagálására. A maszk számít. Tökéletesen nem véd meg, de akkor is számít. És a tetejében másokat közel-tökéletesen megvéd tőlünk, ha úgy adódna. Ha mindenki viselne maszkot, az komolyan lassítaná a járványt. Úgyhogy aki teheti, viseljen maszkot. Persze, megfelelően kell viselni. Ahogy kezet mosni is megfelelően kell. A kettőt körülbelül ugyanolyan bonyolult megtanulni.

A tavaszi-nyári felmelegedés nem igazán vet véget a járványnak. A szingapúri és malájziai adatok alapján most már erre hajlok. Első körben az látszott, Szingapúr esetében, még februárban, hogy lassabb volt a terjedés. Talán mert a vírus termotoleranciája egy kiválasztódási folyamat révén időbe került, míg erősödött. Mostanra viszont dinamikus terjedést látunk Szingapúrban is, Malájziában is.

Over. Na jó, kb. 12 óráig bírtam, itt a folytatás.

36 komment